Higher lactate production from glucose in cultured adipose nucleated stromal cells than for rat adipocytes

Figures & data

Table 1. WAT site cell characteristics of young male Wistar rats.

parameter	units	SC WAT	MES WAT	EPI WAT	p
cell counts
adipocyte	cellsx10^6/g WAT	3.19 ± 0.84	4.59 ± 0.98	2.90 ± 0.35	NS
nucleated stromal cells	cellsx10^6/g WAT	43.8 ± 7.7	59.8 ± 3.8	27.9 ± 7.3	0.0220
red blood cells	cellsx10^6/g WAT	108 ± 51	236 ± 57	150 ± 61	NS
cell fragments	10^6/g WAT	151 ± 50	103 ± 22	105 ± 18	NS
WAT adipocytes recovery	%	70.4 ± 7.6	83.0 ± 8.6	77.2 ± 0.1	–
cell volumes
adipocyte volume	pL/cell	251 ± 30	159 ± 33	309 ± 7	0.0065
nucleated stromal cells	fL/cell	419 ± 28	255 ± 79	256 ± 44	NS
red blood cells	fL/cell	32.4 ± 1.9	32.4 ± 1.9	32.4 ± 1.9	–
red blood cells	% stromal cells	62.8 ± 12.3	79.4 ± 3.3	84.4 ± 2.9	NS
cell fragments and droplets	fL/fragment	<5			–
other tissue data
debris (dry weight)	mg/g WAT	37	59	22	–
water in intact tissue	mg/g WAT	220 ± 63	160 ± 37	64.4 ± 11.2	NS
water in tissue minus debris	mg/g WAT	213 ± 62	152 ± 41	62.9 ± 10.2	NS
fat in intact tissue	mg/g WAT	740 ± 20	744 ± 24	871 ± 12	0.0014
fat in tissue minus debris	mg/g WAT	713 ± 29	701 ± 62	852 ± 1	0.0440
tissue density	g/g WAT	0.9246 ± 0.0130	0.9208 ± 0.0129	0.9282 ± 0.0048	NS
fat density	g/mL WAT	0.922 ± 0.022			–
debris + interstitial space	µl/g WAT	237 ± 97	275 ± 92	145 ± 106	–

The data are the mean ± SD of different [N: PG = 2; MES = 3; SC = 4] 2-rat tissue pools. Statistical significance of the differences between groups (1-way anova). The column p represents the p values corresponding to the effect of WAT site. NS = p > 0.05

Figure 1. Production of lactate by RBCs incubated in medium with 14 mM glucose The data are the mean ± sem of 4 samples of adult rat blood. The blue dots and line coprrespond to samples of blood washed and processed in the same way than tissue extracts. Red dots and line are the results of direct incubation of whole fresh blood, The X axis represents the the number of RBC per well and the Y axis the amount of lactate released in micromoles per day. The p values represented in the Figure correspond to the statistical significance if the correlation between cell numbers and lactate efflux. No statistically significant differences were appreciated between the values for fresh blood and washed RBCs.

Table 2. WAT site cell glucose uptake and metabolite efflux of young male Wistar rats.

cell type & units (per cell and 24 h)		SC WAT		MES WAT		EPI WAT
		7 mM	14mM	7 mM	14mM	7 mM	14mM
glucose uptake
adipocytes	pmol	4.56 ± 0.68	4.94 ± 0.58	7.81 ± 0.68	8.73 ± 0.99	3.36 ± 0.52	4.02 ± 1.95
NSC	pmol	0.344 ± 0.085	0.63 ± 0.29	0.447 ± 0.077	0.811 ± 0.082	0,784 ± 0.150	1.06 ± 0.45
RBC	fmol	5.71 ± 1.70 [*]
lactate efflux
adipocytes	pmol	3.63 ± 0.56	3.90 ± 0.42	3.93 ± 0.91	3.88 ± 1.20	2.47 ± 0.48	2.81 ± 0.42
NSC	pmol	0.647 ± 0.214	0.504 ± 0.183	0.796 ± 0.141	0.876 ± 0.196	0.550 ± 0.222	0.564 ± 0.217
RBC	fmol	11.4 ± 3.4 [*]
glycerol efflux
adipocytes	pmol	1.56 ± 0.35	1.52 ± 0.35	2.26 ± 0.42	2.40 ± 0.33	1.71 ± 0.16	1.95 ± 0.21
NSC	fmol/	not detected
NEFA efflux
adipocytes	pmol	0.401 ± 0.109	0.385 ± 0.119	0,752 ± 0.407	0.360 ± 1.67	0.242 ± 0.038	0.178 ± 0.023
NSC	pmol	not detected

The data are the mean ± sem of samples (N = 4; N = 3 for 14 mM glucose in MES and EPI), each corresponding to two pooled rat tissues; [*] calculated value (from data shown in Figure 1). Statistical significance of the differences between groups (2-way ANOVA). The only significant (p = 0.0008) relationship was that of glucose uptake by adipocytes with respect to WAT site.

Figure 2. Glucose uptake, and lactate, glycerol and NEFA efflux from WAT component cells corresponding to 1 g of tissue SC = subcutaneous WAT (blue); MES = mesenteric WAT (red); EPI = epidydimal WAT (green). Full columns = 7 mM glucose, white-dashed columns = 14 mM glucose. The data are the mean ± sem of two-rat pooled samples (N = 4; N = 3 for 14 mM glucose in MES and EPI) obtained from adult male rats. The data for glucose uptake and lactate efflux correspond to the number of adipocytes, NSC and RBC contained in 1 g of tissue (Table 1) multiplied by their individual uptake/efflux data (Table 2). The data for glycerol and NEFA correspond exclusively to the adipocytes present in 1 g of tissue, since no efflux of either was observed in NSC or RBC. Statistical significance of the differences between groups (2-way ANOVA): the data for site in adipocytes and NSC are indicated in the Figure itself, the absence of data indicates that the differences, if any, were not significant (P > 0.05); no significant differences were observed for the effect of initial glucose concentration.

Table 3. WAT site expression (in specific mRNA copies per cell) of genes related with glycolysis and glycerol metabolism of young male Wistar rats.

gene		cells	SC WAT		MES WAT		EPI WAT		p
			7 mM	14mM	7 mM	14mM	7 mM	14mM	site	glucose
Glut1	glucose transporter 1	adipocytes	75.7 ± 5.0	128 ± 14*	304 ± 56*	287 ± 61	111 ± 11	123 ± 22	<0.0001	NS
		NCS	20.0 ± 4.8	26.3 ± 9.2*	31.1 ± 4.3*	52.6 ± 5.6*	16.3 ± 5.6*	23.3 ± 5.5	0.0050	0.0322
Hk1	hexokinase 1	adipocytes	172 ± 15	222 ± 29*	488 ± 52*	500 ± 35*	343 ± 54	394 ± 108	0.0011	NS
		NCS	11.9 ± 2.6	6.71 ± 4.04	26.0 ± 1.6	32.4 ± 0.1*	18.8 ± 6.7	20.5 ± 4.7	0.0007	NS
Ldha	type a lactate dehydrogenase	adipocytes	1003 ± 196	1274 ± 202*	2271 ± 260*	1963 ± 214	1959 ± 157	1988 ± 154	0.0003	NS
		NCS	95.6 ± 11.6	77.8 ± 11.8*	222 ± 9*	265 ± 38*	189 ± 20	168 ± 13	<0.0001	NS
Ldhb	type b lactate dehydrogenase	adipocytes	164 ± 21	176 ± 8*	332 ± 62*	362 ± 51*	339 ± 32	340 ± 23	0.0003	NS
		NCS	1.15 ± 0.18	0.66 ± 0.37*	3.63 ± 0.48*	1.96 ± 0.69*	3.94 ± 0.48	3.66 ± 0.32	<0.0001	0.0345
Pfkl	phospho-fructo-kinase liver	adipocytes	131 ± 11	195 ± 24	392 ± 73*	404 ± 24*	170 ± 29	182 ± 46	<0.0001	NS
		NCS	15.1 ± 2.6	7.56 ± 3.24	34.1 ± 1.2	41.2 ± 7.3*	17.2 ± 4.8	16.9 ± 3.3	<0.0001	NS
Phgdh	3-phospho-glycerate DH	adipocytes	17.5 ± 1.5	25.5 ± 3.7*	52.1 ± 11.6*	58.0 ± 9.8*	42.3 ± 4.7	44.0 ± 9.2	0.0013	NS
		NCS	2,64 ± 0.33	2.44 ± 0.53*	7.23 ± 0.96	8.14 ± 0.81*	5.40 ± 1.46	5.67 ± 1.60	0.0013	NS
Gpam	glycerol-3P acyl-transferase	adipocytes	15.6 ± 1.1	19.3 ± 4.7*	58.3 ± 10.7*	54.7 ± 15.6	38.8 ± 2.4*	34.7 ± 10.7*	0.0018	NS
		NCS	0.478 ± 0.100	0.439 ± 0.115*	1.12 ± 0.25	1.32 ± 0.54*	0.982 ± 0.137	0.904 ± 0.136	0.0298	NS
Pdk4	pyruvate DH kinase 4	adipocytes	4.76 ± 2.36	5.16 ± 2.52*	19.9 ± 15.9*	9.50 ± 1.81*	2.83 ± 0.92	2.72 ± 0.85	NS	NS
		NCS	0.061 ± 0.007*	0.024 ± 0.024*	0.050 ± 0.016	0.047 ± 0.002*	0.063 ± 0.009*	0.013 ± 0.003*	NS	NS
Fas	fatty acid synthase	adipocytes	97.2 ± 6.3	191 ± 30*	302 ± 54*	478 ± 84*	181 ± 27	241 ± 63	0.0004	0.0166
		NCS	5.42 ± 0.83	3.49 ± 0.99*	11.2 ± 1.8	19.7 ± 5.1*	8.62 ± 1.35	10.4 ± 1.9	0.0012	NS
Hsl	hormone-sensitive lipase	adipocytes	45.0 ± 5.5	38.4 ± 5.5*	48.6 ± 8.6*	48.4 ± 6.5	98.3 ± 34.1	109 ± 54	NS	NS
		NCS	0.739 ± 0.282	0.364 ± 0.079	0.966 ± 0.182	1.01 ± 0.15*	0.566 ± 0.050*	0.599 ± 0.011	0.0195	NS
Atgl	adipose TAG lipase	adipocytes	218 ± 20	320 ± 45	488 ± 65*	560 ± 56*	547 ± 71	465 ± 74*	0.0005	NS
		NCS	5.69 ± 0.85	5.22 ± 0.67*	11.8 ± 2.8	18.4 ± 1.03*	6.08 ± 1.48	6.08 ± 0.92	<0.0001	NS
Lpl	lipoprotein lipase	adipocytes	859 ± 42	1106 ± 228*	1437 ± 222*	1537 ± 238*	1466 ± 262	1681 ± 358	NS	NS
		stromal	2.62 ± 0.87	0.89 ± 0.20*	3.50 ± 0.38	3.51 ± 1.37*	3.32 ± 0.42	3.53 ± 0.26	0.0412	NS

The data are the mean ± sem of N = 4 different (* N = 3) two- rat pooled samples. Data in italics were obtained with 30 or more cycles. Statistical significance of the differences between groups (2-way ANOVA). The far right columns show the p values for site and initial glucose concentration. NS = p > 0.05

Table 4. List of primers used.

gene	protein	direction	sequences	bp
Glut-1	glucose transporter type 1, erythrocyte/brain	5ʹ >	GCTCGGGTATCGTCAACACG	97
		> 3’	ATGCCAGCCAGACCAATGAG
Hk1	hexokinase type 1	5ʹ >	TGGATGGGACGCTCTACAAA	100
		> 3’	GACAGGAGGAAGGACACGGTA
Ldha	L-lactate dehydrogenase a	5ʹ >	AAAGGCTGGGAGTTCATCCA	96
		> 3’	CGGCGACATTCACACCACT
Ldhb	L-lactate dehydrogenase b	5ʹ >	GCGAGAACTGGAAGGAGGTG	145
		> 3’	GGGTGAATCCGAGAGAGGTTT
Pfkl	phospho-fructokinase, liver, b-type	5ʹ >	CAGCCACCATCAGCAACAAT	90
		> 3’	TGCGGTCACAACTCTCCATT
Pfkm	phospho-fructokinase, muscle	5ʹ >	CATCCCATTTGTGGTCATTCC	149
		> 3’	TAAACACTCGCCGCTTGGT
Phgdh	phospho-glycerate dehydrogenase	5ʹ >	CTGAACGGGAAGACACTGGGAA	138
		> 3’	AACACCAAAGGAGGCAGCGA
Gpam	glycerol-3-phosphate acyl-transferase, mitochondrial	5ʹ >	GGTGAGGAGCAGCGTGATT	129
		> 3’	GTGGACAAAGATGGCAGCAG
Pdk4	pyruvate dehydrogenase kinase, isoenzyme 4	5ʹ >	CTGCTCCAACGCCTGTGAT	142
		> 3’	GCATCTGTCCCATAGCCTGA
Fas	fatty acid synthase	5ʹ >	CCCGTTGGAGGTGTCTTCA	117
		> 3’	AAGGTTCAGGGTGCCATTGT
Hsl	lipase, hormone sensitive	5ʹ >	TCCTCTGCTTCTCCCTCTCG	108
		> 3’	ATGGTCCTCCGTCTCTGTCC
Atgl	adipose triacylglycerol lipase	5ʹ >	CACCAACACCAGCATCCAAT	120
		> 3’	CGAAGTCCATCTCGGTAGCC
Lpl	lipoprotein lipase	5ʹ >	TGGCGTGGCAGGAAGTCT	116
		> 3’	CCGCATCATCAGGAGAAAGG
Arbp	0S acidic ribosomal phospho-protein PO [housekeeping gene]	5ʹ >	CCTTCTCCTTCGGGCTGAT	122
		> 3’	CACATTGCGGACACCCTCTA

Figure 3. Number of copies of glycolysis-related genes in adipocytes and NSC contained in 1 g of WAT from different sites (SC, MES and EPI) or male adult rats The data correspond to the mean ± sem of two-rat pooled samples (N = 4 or N = 3 in the groups indicated in Table 3). The data have been presented in a of magnitude logarithmic scale (with more than five orders of magnitude span) for easy direct comparison of the abundance of all gene transcripts. The values shown were calculated from the data presented in Tables 1 and 3. Dot and line colours are represented in the Figure: Adipocytes: orange A SC, red A MES, yellow A EPI; NSC: light blue NSC SC, blue NSC-EPI, green NSC-EPI., Statistical significance of the differences between groups (3-way ANOVA). T: corresponds to differences between the ‘type’ or cell (adipocyte vs. NSC), in black, S: refers to the differences between ‘sites’ (SC, MES, EPI) within the same cell group, in purple, and G represents the statistically significant differences in expression induced by the initial ‘glucose’ concentrations, in blue.

Figure 4. Number of copies of glycerol and lipid metabolism-related genes in adipocytes and NSC contained in 1 g of WAT from different sites (SC, MES and EPI) or male adult rats The data correspond to the mean ± sem of 4 different two-pooled rat samples. All conventions are the same described for Figure 3.