Influence of glucose and insulin in human adipogenic differentiation models with adipose-derived stem cells.

Figures & data

Table 1. Comparative assessment of adipogenic media supplementation for the in vitro differentiation of adipose-derived stem cells (ASC). Reference for standard differentiation media established in our laboratory is underlined.

Source	Basal Media	Glucose (mM)	Insulin (µM)	Further Supplementation
[30]	DMEM/F12	17.5	1.7	10% FCS, 0.5 mM IBMX, 1 µM dexamethasone, 0.1 mM indomethacin
[31]	DMEM/F12	17.5	0.86	10% FCS, 0.5 mM IBMX, 1 M dexamethasone, 1 M rosiglitazone
[32]	DMEM/F12	17.5	0.5	0.25 mM IBMX, 0.1 µM dexamethasone, 33 μM biotin, 1 μM troglitazone, 10 μg/ml transferrin, 200pM T3
[33]	DMEM/F12	17.5	0.1	0.25 IBMX, 1 µM dexamethasone,
[34]	MEM	5.5	10	10% FCS, 0.5 mM IBMX, 1 µM dexamethasone, and 0.2 mM indomethacin, 1% antibiotic/antimycotic
[35]	DMEM/F12	17.5	0.17	10% FCS, 0.45 mM IBMX, 0.1 µm dexamethasone, 0.2 mM indomethacin, 1 µm rosiglitazone
[36]	High glucose DMEM	25	1.7	10% FCS, 0.5 IBMX, 0.2 mM indomethacin
[37]	DMEM/F12	17.5	0.85	0.1 M IBMX, 1 μM dexamethasone, 100 μM ascorbic acid, 20 nM sodium selenite, 0.2 nM triiodothyronine, 1 μM rosiglitazone

Table 2. Phenotypic characterization of isolated human adipose-derived stem cells (hASC) at passage 0. Columns show manufacturers with catalogue numbers of used antibodies, donors (1–6) and mean ± SEM. Data are presented as percentage of positive cells for the particular surface marker measured by flow cytometry of 5000 cells.

Antigen	Manufacturer	1	2	3	4	5	6	mean ± SEM
CD 11b	eBioscience; 25–0118	2	6	15	7	2	5	6 ± 2
CD 13	Biolegend; 301,703	95	93	89	93	79	87	89 ± 2.4
CD 19	Beckmann Coulter; A07768	1	0	4	11	1	2	3 ± 1.7
CD 31	Beckmann Coulter; IM1431U	0	2	9	6	0	11	5 ± 1.9
CD 34	Beckmann Coulter; A21691	0	32	11	8	6	11	11 ± 4.5
CD 44	Biolegend; 338808	96	98	97	98	81	99	95 ± 2.8
CD 45	Beckmann Coulter; IM2652U	0	10	21	11	12	46	17 ± 6.5
CD 73	Biolegend; 344003	91	90	68	93	90	56	81 ± 6.3
CD 90	Beckmann Coulter; PN IM3703	96	96	88	97	99	69	91 ± 4.6
CD 105	Beckmann Coulter; PN A07414	17	93	75	67	33	79	61 ± 12
HLA-DR	Imgenex; IMG-6881AF-488	2	2	13	8	0	31	9 ± 4.8

Table 3. Supplementation of glucose, insulin and mannitol used in cell culture media with reference to the standard differentiation medium for the adipogenic differentiation of human adipose-derived stem cells (hASC).

Medium	Glucose (mM)	Insulin (µM)	Mannitol (mM)
GM: Growth medium	17.5
DM: Standard differentiation medium	17.5	1.7
2I: 2-fold insulin concentration	17.5	3.4
4I: 4-fold insulin concentration	17.5	6.8
2G: 2-fold glucose concentration	35	1.7
2M: Mannitol control for 2G	17.5	1.7	17.5
4G: 4-fold glucose concentration	70	1.7
4M: Mannitol control for 4G	17.5	1.7	52.5
2GI: 2-fold glucose and insulin concentration	35	3.4
2MI: Mannitol control for 2GI	17.5	3.4	17.5
4GI: 4-fold glucose and insulin concentration	70	6.8
4MI: Mannitol control for 4GI	17.5	6.8	52.5

Figure 1. Schematic timeline of the adipogenic differentiation protocol. Human adipose-derived stem cells (hASC) were grown to confluence (defined as day 0) and differentiated in standard media (DM) or with glucose and insulin for a period of 28 days. Cells cultured in growth media (GM) for equal time served as an undifferentiated control and D-Mannitol was consistently used as an osmotic control for glucose treated cells.

Table 4. List of reference (RPL37, RPS12) and target (LPL, PPARγ) genes used for qRT-PCR. Forward (F) and reverse (R) sequences of primer pairs and expected amplicon length in base pairs (bp).

Gene	Acc Number^1	Sequence 5ʹ-> 3’	Product size (bp)
RPL37	NM_000997.4	F: GCCAAGCGCAAGAGAAAGTA (20) R: CACGGAATCCATGCCTGAATC (21)	118
RPS12	NM_001016.3	F: TGACAACAAGAAACTAGGAGAATG (24) R: TACTACACAACTGCAACCAACCAC (24)	91
LPL	NM_000237.2	F: AGCGCTCCATTCATCTCTTCA (21) R: GATTGTTGCAGCGGTTCTTTC (21)	132
PPARγ	NM_015869.4	F: GCTGTTATGGGTGAAACTCTG (21) R: GCGATCTCTGTGTCAACCAT (20)	116

¹National Center for Biotechnology Information (NCBI)

Figure 2. Fluorescence microscopic visualization of live/dead assay after 28 days of adipogenic differentiation of human adipose-derived stem cells. Vital cells with numerous large lipid vacuoles stained green, dead cells stained read. Overlay at 20x magnification, scale bar: 50 µm. (a) undifferentiated control (GM); (b) standard differentiation media (DM); (c) fourfold glucose concentration (4G); (d) fourfold insulin concentration (4I).

Figure 3. Accumulation of lipid droplets over the time of adipogenic differentiation in DM visualized by light microscopy (20x magnification, scale bar: 100 µm). (a) undifferentiated adipose-derived stem cells (hASC) 7 days after isolation; (b–e) 7, 14, 21 and 28 days after differentiation was induced; (f) Oil-Red-O stained cells, 28 days after differentiation was induced.

Figure 4. Histological stain after 28 days of differentiation in supplemented adipogenic media. Cultures with fourfold glucose (4G: a, b) and fourfold insulin (4I: c, d) concentrations at 20x (a, c; scale bar: 100 µm) and 40x magnification (b, d; scale bar: 50 µm). Standard differentiation (e) and mannitol treatment as an osmotic control for 4G (f) are presented at 20x magnification. Lipid-containing vacuoles were visualized by Oil-Red-O staining (red), cell nuclei were stained by haematoxylin (blue). Compared to high insulin treated cells, Oil-Red-O stained area was significant higher in fourfold glucose conditions with larger lipid droplets (b) which is characteristic for mature adipocytes.

Figure 5. Relative differences in lipid accumulation after 28 days of adipogenic differentiation compared to standard media (DM). Oil-Red-O stained area was quantified in 10 randomly selected microscopic fields by the java-based image processing program ImageJ. Values are presented as mean ± SEM, students t-test was used for statistical analysis; *p < 0.05 and **p < 0.01 for significant results compared to DM. (a) Glucose increases lipid levels, however not significantly (DM: standard differentiation media; 2G, 4G: twofold and fourfold glucose concentration). (b) Insulin significantly reduces lipid accumulation (DM: standard differentiation media; 2I, 4I: twofold and fourfold insulin concentration) (c) which can be partially rescued by glucose (DM: standard differentiation media; 2GI, 4GI: twofold and fourfold glucose and insulin concentration; 2MI, 4MI: mannitol control for combined treatment).

Figure 6. Fold change of PPARγ (a) and LPL (b) gene expression, 28 days after adipogenic differentiation induction, analysed by qRT-PCR. ΔΔCT method was used for relative quantification with RPL37 and RPS12 as reference genes compared to gene expression in standard differentiation media (DM). Mean values are expressed in relative units ± SEM. Statistical comparison between groups was performed with students t-test; *p < 0.05.

Figure 7. Metabolite turnover, analysed in conditioned media over the period of 4 weeks. Glucose uptake and lactate production in (a) human adipose-derived stem cells (hASC) cultured in growth media (GM) and (b) standard differentiation media (DM). Values are expressed as mean ± SEM, students t-test was used for statistical comparison between groups; *p < 0.05, **p < 0.01.

Cervelli V, Gentile P, Scioli MG, et al. Application of platelet-rich plasma in plastic surgery: clinical and in vitro evaluation. Tissue Eng Part C Methods. 2009;15(4):625–634.

 PubMed Web of Science ®Google Scholar

Tang Y, Pan Z, Zou Y, et al. A comparative assessment of adipose‐derived stem cells from subcutaneous and visceral fat as a potential cell source for knee osteoarthritis treatment. J.Cell.Mol.Med. 2017;21:2153–2162.

 Web of Science ®Google Scholar

Morandi EM, Verstappen R, Zwierzina ME, et al. ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells. Sci.Rep. 2016;6:28889.

 PubMed Web of Science ®Google Scholar

Chon S, Pappas A. Differentiation and characterization of human facial subcutaneous adipocytes. Adipocyte. 2015;4(1):13–21.

 PubMed Web of Science ®Google Scholar

Higuchi M, Dusting GJ, Peshavariya H, et al. Differentiation of human adipose-derived stem cells into fat involves reactive oxygen species and Forkhead box O1 mediated upregulation of antioxidant enzymes. Stem Cells Dev. 2012;22(6):878–888.

 PubMed Web of Science ®Google Scholar

Lund P, Pilgaard L, Duroux M, et al. Effect of growth media and serum replacements on the proliferation and differentiation of adipose-derived stem cells. Cytotherapy. 2009;11(2):189–197.

 PubMed Web of Science ®Google Scholar

Verseijden F, Jahr H, Posthumus-van Sluijs SJ, et al. Angiogenic capacity of human adipose-derived stromal cells during adipogenic differentiation: an in vitro study. Tissue Eng Part A. 2008;15(2):445–452.

 Web of Science ®Google Scholar

Rodriguez A, Elabd C, Delteil F, et al. Adipocyte differentiation of multipotent cells established from human adipose tissue. Biochem.Biophys.Res.Commun. 2004;315(2):255–263.

 PubMed Web of Science ®Google Scholar

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article.