Genetic susceptibility to rotavirus infection in Chinese children: a population-based case–control study

Figures & data

Table 1. Primer sequences of SSP-PCR and the expected product sizes

Name	Note	Sequences (5′ to 3′)	Product size
P1773-w385A	FUT2 wild-type forward	AGGAGGAATACCGCCACAT	575 bp
P1774-m385T	FUT2 mutated forward	GAGGAGGAATACCGCCACT	576 bp
P1775-w428G	FUT2 wild-type forward	GCTACCCCTGCTCCTGG	529 bp
P1776-m428A	FUT2 mutated forward	CGGCTACCCCTGCTCCTA	530 bp
P1777-w571C	FUT2 wild-type forward	TAGGGGTC CATGTTCGCC	389 bp
P1778-m571T	FUT2 mutated forward	GTAGGGGTCCATGTTCGCT	390 bp
P1772-fut2 rev	FUT2 reverse primer	GGCTGCCTCTGGCTTAAAG	/
P1779-hGH	hGH forward	GCCTTCCCAACCATTCCCTT	428 bp
P1780-hGH rev	hGH reverse	TCACGGATTTCTGTTGTGTTTC	/

Figure 1. Assembly of participants in case–control study

Table 2. Consistence between FUT2 A385T mutation and secretor status

A385T mutation	Secretor status (n, %)			Total
	Secretor	Partial secretor	Non-secretor
Wild (AA)	32(94.1)	0	2(5.9)	34
Heterozygous mutation (TA)	41(83.7)	5(10.2)	3(6.1)	49
Homozygous mutation (TT)	17(23.6)	31(43.1)	24(33.3)	72

Two-tailed Fisher’s exact test, P < 0.0001.

Table 3. Association between HBGA phenotype and RV infection

	RV infection (n,%)				RV diarrhea (n,%)				RV IgG & RV diarrhea status (n,%)
Status	Yes (n = 754)	Not (n = 161)	OR (95%CI)	P value	Yes (n = 235)	Not (n = 680)	OR (95%CI)	P value	Both positive (n = 212)	Both negative (n = 138)	OR (95%CI)	P value
Blood type
H1	378 (50.1)	61 (37.9)	1.7 (1.2–2.3)	.005	139 (59.1)	300 (44.1)	1.8(1.4–2.5)	<.0001	127 (59.9)	48 (34.8)	2.8 (1.8–4.4)	<.0001
A	274 (36.3)	58 (36.0)	1.0 (0.7–1.4)	1	77 (32.8)	255 (37.5)	0.8 (0.6–1.1)	.208	70 (33.0)	51 (37.0)	0.8 (0.5–1.3)	.49
B	301 (39.9)	49 (30.4)	1.5 (1.1–2.2)	.03	109 (46.4)	241 (35.4)	1.6 (1.2–2.1)	.003	99 (46.7)	39 (28.3)	2.2 (1.4–3.5)	.0008
O	257 (34.1)	60 (37.3)	0.9 (0.6–1.2)	.47	75 (31.9)	242 (35.6)	0.8 (0.6–1.2)	.308	67 (31.6)	52 (37.7)	0.8 (0.5–1.2)	.25
AB	78 (10.3)	6 (3.7)	2.9 (1.3–6.9)	.006	26 (11.1)	58 (8.5)	1.3 (0.8–2.2)	.246	24 (11.3)	4 (2.9)	4.3 (1.5–12.6)	.004
Lewis type
Le^b	686 (91.0)	137 (85.1)	1.8 (1.1–2.9)	.03	222 (94.5)	601 (88.4)	2.3 (1.2–4.1)	.007	205 (96.7)	118 (85.5)	4.9 (2.0–12.1)	.0003
Le^y	654 (86.7)	130 (80.7)	1.6 (0.9–2.4)	.062	222 (94.5)	564 (82.9)	3.5 (1.9–6.4)	<.0001	201 (94.8)	110 (79.7)	4.7 (2.2–9.7)	<.0001
Le^a	576 (76.4)	112 (69.6)	1.4 (0.9–2.1)	.07	187 (79.6)	501 (73.7)	1.4 (0.9–1.9)	.071	171 (80.7)	96 (69.6)	1.8 (1.1–3.0)	.02
Le^x	256 (34.0)	61 (37.9)	0.8 (0.6–1.2)	.36	85 (36.2)	232 (34.1)	1.2 (0.9–1.6)	.569	76 (35.8)	52 (37.7)	0.9 (0.6–1.4)	.73
Secretor status
Secretor	618 (82.0)	117 (72.7)	1.7 (1.2–2.5)	.008	216 (91.9)	519 (76.3)	3.5 (2.1–5.8)	<.0001	196 (92.5)	97 (70.3)	5.2 (2.8–9.7)	<.0001
Partial secretor	114 (15.1)	37 (23.0)	0.6 (0.4–0.9)	.019	17 (7.2)	134 (19.7)	0.3 (0.2–0.5)	<.0001	14 (6.6)	34 (24.6)	0.2 (0.1–0.4)	<.0001
Non-secretor	22 (2.9)	7 (4.3)	0.7 (0.3–1.6)	.33	2 (0.9)	27 (4.0)	0.2 (0.1–0.9)	.041	2 (0.9)	7 (5.1)	0.2 (0.04–0.8)	.03

^aUnadjusted odds ratio with 95% confidence interval.

^bAn RV diarrhea case was defined as a laboratory-confirmed RV diarrhea, and a control was defined as eligible children without diarrhea during the surveillance period An RV infection was defined as RV-specific IgG positive, regardless of the status of RV diarrhea during surveillance.

^cSecretor status was defined as Lea−b+, Lex−y⁺ or H⁺; weak secretor was defined as Le^a+b+ or Le^x+y+; and non-secretor was defined as Le^a+b− and/or Le^x+y−, Le^a−b−/Le^x−y− and H antigens negative.

Figure 2. Association between the titers of anti-RV IgG and secretor status