Engineering Saccharomyces cerevisiae for improvement in ethanol tolerance by accumulation of trehalose

Figures & data

Table 1. Strains used in this study.

Strain Name	Properties or product	Reference or source
E. coli TOP10F'	F’ [lacI^q Tn10(Tet^r)] mcrA (mrr-hsdRMS-mcrBC) 80lacZM15lacX74 recA1araD139 (ara-leu)7697 galUgalKrpsL (Str^r) endA1 nupG	Invitrogen
S. cerevisiae (BCRC 21685) (SC)	Wild type	Bioresources Collection and Research Center, Taiwan
S. cerevisiae with overexpression of tps1 (SCT)	Carrying pGAPZC-tps1 vector	This study
S. cerevisiae with overexpression of tps1 and deletion of nth1 gene (SCTΔN)	Carrying pGAPZC-tps1 vector and gene disruption cassette (Upstream nth1 region-kanMX6-Downstream nth1 region replaces the nth1 gene).	This study

Table 2. Oligonucleotides used in this study.

Oligonucleotide	Sequence 5′–3′	Primer design	Purpose	Source
Tps1-F	ACTTTCGAAACGATGGGTACTACGGATAACGCTAAGGCGCAACTGACCT	BstBI	Amplification of tps1 gene	This study
Tps1-R	ACTGGTACCTCAGTGATGGTGATGGTGATGGTTTTTGGTGGCAGAGGAG	KpnI
VTF	TTCGAAACGATGGGTACTAC	Positioned from the start codon of the tps1 gene	Verification of tps1 gene insertion
VR	AGTGATGGTGATGGTGATGG	6xHis-tag sequence
L1	CACAAGGTTATCAATATGAAACTTGCGCGATCACCGATTTA	Positioned 265 bp from the start codon of the nth1 gene	To construct upstream region of nth1 gene
L2	GTCGACCTGCAGCGTACGTGGACCCTTGTGGTACTGTCAGAGACCTCGTGGACATCCATTCTACTGATTTTTTT	5′ end homologous to 5′ kanMX region
L3	CGAGCTCGAATTCATCGATGTTGAGCGTGTGTTAATACCCTACGAGACCGACACCGTAGTTGAGATAATATATA	5′ end homologous to 3′ kanMX region	To construct downstream region of nth1 gene
L4	AAGAAAAAGAAACTGTTTTGTCCTTGGAAAAAAAGCACTACCTA	Positioned 391 bp from the stop codon of the nth1 gene
kanMX-F	AAAAAAATCAGTAGAATGGATGTCCACGAGGTCTCTGACAGTACCACAAGGGTCCACGTACGCTGCAGGTCGAC	5′ end had 18 bases extensions homologous to the 3′ side of the UP nth1 region.	To construct kanMX region	Saccharomyces Genome Deletion Project.
kanMX-R	TATATATTATCTCAACTACGGTGTCGGTCTCGTAGGGTATTAACACACGCTCAACATCGATGAATTCGAGCTCG	5′ end had 18 bases extensions homologous to the 5′ side of the DOWN nth1 region
DC-F	CCTATCGTTTTCCGTAGAGT	Located within the UP nth1 region	For amplification of disruption cassette	This study
DC-R	CCTGAAGTCGAGTAAACAGA	Located within the DOWN nth1 region
A1	CAGGAGCATCGTGTAGGAC	Positioned 373 bp from the start codon of the nth1 gene	Gene deletion verification primer	This study
D1	AAAAGGTCACATGCTTATAATCAAC	Positioned 514 bp from the stop codon of the nth1 gene
B	AAACGACGATTACCTTGACTACTTG	Located within the coding region of the nth1 gene	Gene deletion verification primer	Saccharomyces Genome Deletion Project.
kanB	CTGCAGCGAGGAGCCGTAAT	Positioned 250 bp downstream of the 5 ′-end of the kanMX region
C	TTGTGGTTGAAAAATATGATGTCAC	Located within the coding region of the nth1 gene
kanC	TGATTTTGATGACGAGCGTAAT	Positioned 587 bp upstream of the 3 ′ end of the kanMX region
Nth1F	ATGAGTCAAGTTAATACAAGCCAAG	Positioned from the start codon of the nth1 gene	For amplification of nth1 gene	This study
Nth1R	TAGTCCATAGAGGTTTCTTTCTTG	Positioned from the stop codon of the nth1 gene

The underlined bases encode restriction site and italicized bases encode 6xHis-tag.

Saccharomyces Genome Deletion Project. (http://www-sequence.stanford.edu/group/yeast_deletion_project/project_desc.html)

Figure 1. Construction of deletion cassette with long flanking homology regions by overlapping PCR. In the first round of PCR, the upstream sequence of the nth1 gene, the kan^r marker gene and the downstream sequence of the nth1 gene were amplified in 3 different PCR reaction tubes. S. cerevisiae genomic DNA was used as template for amplification of 0.26 kb 5′ UP nth1 region and 0.4 kb 3′ DOWN nth1 region by using primers L1, L2, and L3, L4, respectively. The pFA6a-kanMX6 vector was used as a template for amplification of kanMX region by using primers kanMX-F and kanMX-R. In the second round of PCR, the 5′ UP nth1 region and kanMX region were fused together by using primers L1 and kanMX-R. In the third round of PCR, the 3′ DOWN nth1 region and second round PCR product (5′ UP nth1 region-kanMX region) were fused together by using primers L1 and L4. The third round PCR product (5′ UP nth1 region- kanMX region - 3′ DOWN nth1 region) was cloned into pGEMT vector for construction of the disruption cassette. After transformation of the disruption cassette into S. cerevisiae, homologous recombination takes place with the deletion of target gene.

Figure 2. Schematic diagram of verification primer position.

Figure 3. Verification of gene deletion strain. Genomic DNA of wild strain, heterozygous strain, and homozygous strain (Agarose gel image A, B, and C, respectively) were used as templates for PCR with different sets of primers. In all of the gels, Lane M: Gene-Direx 100 bp DNA Ladder, lane 1: primers Nth1-F and R, lane 2: primers L1 and L4, lane 3: primers A1 and kan B, lane 4: primers A1 and B, lane 5: primers D1 and kan C, lane 6: primers D1 and C.

Figure 4. PCR confirmation of the recombinant expression vector pGAPZC-tps1 (A) and Over-expression of TPS (B) in SC (wild strain), SCT (tps1 overexpression strain) and SCTΔN (tps1 overexpression and nth1 deletion strain).

Table 3. Intracellular trehalose content of yeast cells during growth and under stress.

	Intracellular trehalose content of cell (mg/g dry weight) during growth
Incubation time (h)^1	1	24	48	72
SC	9.2 ± 0.2^c^a-d	20.9 ± 0.1^b^a-d	39.3 ± 0.7^a^a-d	38.7 ± 0.7^a^a-d
SCT	12.2 ± 0.6^d^a-d	22.7 ± 0.2^c^a-d	40.1 ± 1.3^b^a-d	48.1 ± 2.9^a^a-d
SCTΔN	24.9 ± 1.4^c^*	27.0 ± 0.1^c^*	58.8 ± 1.4^b^*	75.4 ± 3.5^a^*
	Intracellular trehalose content of cell (mg/g dry weight) under stress
Ethanol concentration^2	0%	10%	15%
SC	9.2 ± 0.2^c^a-d	25.3 ± 2.5^b^a-d	63.7 ± 0.9^a^a-d
SCT	12.2 ± 0.6^c^a-d	33.0 ± 1.8^b^a-d	67.8 ± 0.7^a^a-d
SCTΔN	24.9 ± 1.4^c^*	59.9 ± 1.6^b^*	85.1 ± 0.2^a^*

¹  Overnight grown cells were incubated for different times in YPD medium without adding ethanol.

² Overnight grown cells were incubated for another 1 h in YPD medium with addition of different amounts of ethanol.

SC: wild type Saccharomyces cerevisiae

SCT: S. cerevisiae with overexpression of tps1

SCTΔN: S. cerevisiae with overexpression of tps1 and deletion of nth1 gene

* Means in the same column are significantly different. One-way ANOVA, Duncan's multiple range test, p < 0.05.

^a-d Means in the same row followed by different letters are significantly different. One-way ANOVA, Duncan's multiple range test, p < 0.05.

Figure 5. Effect of ethanol concentrations on 24 h growth of wild strain (SC) and engineered strain (SCTΔN). Control (C) is the initial OD of strains. Data are presented as the means ± SD (n = 3). *Significantly higher than the other group. One-way ANOVA, Student's t test, P < 0.05. Bar values with the different letters (A, B, C, D, E, F for SC, while a, b, c, d, e, f, g for SCTΔN) are significantly different. One-way ANOVA, Duncan's multiple range test, P < 0.05.

Figure 6. Ethanol production capacities of wild strain (SC) and engineered strain (SCTΔN). Ethanol concentration in g/L (triangle), biomass Log CFU/mL (square) and residual glucose concentration in % (circle) of SC (wild strain) (closed) and SCTΔN (tps1 overexpression and nth1 deleted strain) (open) grown in YP broth (10 g/L yeast extract, 20 g/L peptone) containing different concentrations of glucose. A: 10% glucose; B: 15% glucose; C: 20% glucose; D: 25% glucose; E: 30% glucose; F: Ethanol yield (%) after 96 h of incubation. Data are presented as the means ± SD (n = 3). *Significantly higher than the other group. One-way ANOVA, Student's t test, P < 0.05. Bar values of the ethanol yield (%) with the different letters (a, b, c, d for SC and A, B, C, D for SCTΔN) are significantly different. One-way ANOVA, Duncan's multiple range tests, P < 0.05.