Circular RNA circ_0000467 regulates colorectal cancer development via miR-382-5p/EN2 axis

Figures & data

Table 1. Primer sequence

Gene	Sequence
circ_0000467	F: 5'- ACACAATGGGACTTAAAAATGCGA −3' R: 5'- ACAGATCATCTTTCACATCAGTCT −3’
EN2	F: 5'- CTACTGTACGCGCTACTCGG −3' R: 5'- CCCGTGGCCTTCTTGATCTT −3’
GAPDH	F: 5'- GGGAAATCGTGCGTGACATTAAG −3' R: 5'- TGTGTTGGCGTACAGGTCTTTG −3’
miR-382-5p	F: 5'- ATCCGTGAAGTTGTTCGTGG −3' R: 5'- TATGGTTGTAGAGGACTCCTTGAC −3’
U6	F: 5'- GCTTCGGCAGCACATATACTAAAAT −3' R: 5'- CGCTTCACGAATTTGCGTGTCAT −3’
Note: F, forward; R, reverse.

Table 2. Correlations between circ_0000467 expression and clinical characteristics in CRC patients

Pathological indicators	Number of patients	Circ_0000467		P-value (*P < 0.05)
		High expression	Low expression
All cases	69	34	35
Age
<47	36	15	21	0.187
≥47	33	19	14
Gender
Female	21	12	9	0.387
Male	48	22	26
TNM stage
I–II	33	12	21	0.040*
III–IV	36	22	14
Tumor size
<5 cm	37	14	23	0.041*
≥5 cm	32	20	12
Tumor location
Colon	34	15	19	0.119
Rectum	35	22	13
Histology grade
Well	31	11	20	0.022*
Moderate/poor	38	24	14

Figure 1. The expression of circ_0000467 was up-modulated in CRC

a) Differential expression of circRNAs in GSE138589 and GSE142837. b) Circ_0000467 was dysregulated in both GSE138589 and GSE142837. c) Circ_0000467 expression in 69 paired CRC tissues and matched adjacent tissues was examined by qRT-PCR. d) Circ_0000467 expression in CRC cell lines (SW480, SW620, HT29, RKO, and HCT116) and the FHC cells was examined by qRT-PCR. e) The subcellular distribution of circ_0000467 was analyzed by cellular RNA fractionation assays. GAPDH was mainly localized in the cytoplasm and U6 was mainly localized in the nucleus, which were used as a negative control.***P < 0.001.

Figure 2. Knockdown of circ_0000467 impeded the multiplication, migration, and invasion of CRC cells

a Three siRNAs against circ_0000467 (si-circ_0000467#1, si-circ_0000467#2, and si-circ_0000467#3) were transfected into SW620 and HT29 cells, and circ_0000467 expression was detected by qRT-PCR.b MTT experiment was performed to detect the multiplication of SW620 and HT29 cells after the transfection.c Transwell experiment was utilized to detect migration and invasion of SW620 and HT29 cells after the transfection.d Western blot was executed to detect the EMT markers in SW620 and HT29 cells after the transfection.*P < 0.05, **P < 0.01, and ***P < 0.001.

Figure 3. MiR-382-5p was a downstream target of circ_0000467

a Bioinformatics analysis predicted that the sequence of miR-382-5p matched the sequences of circ_0000467, and WT-circ_0000467 and MUT-circ_0000467 luciferase reporter vectors were constructed.b The miR-382-5p mimics or miR control was co-transfected with WT-circ_0000467 or MUT-circ_0000467, respectively, into HEK293T cells. After 48 h, the luciferase activity of each group of cells was measured.c The complex containing circ_0000467 and miR-382-5p in SW620 and HT29 cells was immunoprecipitated by anti-Ago2, which was confirmed by RIP assay.d RNA pull-down assay was carried out to verify the interactions between circ_0000467 and miR-382-5p.e qRT-PCR was implemented to examine miR-382-5p expression in 69 paired CRC tissues and matched adjacent tissues.f qRT-PCR was employed to examine miR-382-5p expression in CRC cell lines and FHC cells.g MiR-382-5p expression in SW620 and HT29 cells transfected with si-circ_0000467 was detected by qRT-PCR.h Pearson’s correlation analysis was utilized to evaluate the correlations between circ_0000467 expression and miR-382-5p expression in CRC tissues.**P < 0.01, ***P < 0.001, and ‘ns’ indicates that the difference was not statistically significant.

Figure 4. EN2 was a direct target of miR-382-5p

a Bioinformatics analysis predicted that the sequence of EN2 3’UTR matched the sequence of miR-382-5p, and WT-EN2 and MUT-EN2 luciferase reporter gene vectors were constructed.b The miR-382-5p mimics or miR control was co-transfected with WT-EN2 or MUT-EN2, respectively, into HEK293T cells, and the luciferase activity of each group of cells was measured.c The miR-382-5p mimics were transfected into SW620 and HT29 cells, and the transfection efficiency was detected by qRT-PCR.d Western blot was utilized to detect EN2 protein expression in SW620 and HT29 cells transfected with miR-382-5p mimic.e qRT-PCR was conducted to examine EN2 expression in 69 paired CRC tissues and matched adjacent normal tissues.f Pearson’s correlation analysis was utilized to evaluate the correlations between the expression levels of EN2 and miR-382-5p in CRC tissues.g Western blot was employed to detect EN2 protein expression in SW620 and HT29 cells co-transfected with si-circ_0000467 and miR-382-5p inhibitor.*P < 0.05, **P < 0.01, ***P < 0.001.

Figure 5. Circ_0000467 enhanced the multiplication and invasion of CRC cells via miR-382-5p/EN2 axis

a Western blot was employed to detect EN2 protein expression in SW620 and HT29 cells transfected with si-circ_0000467 and pcDNA3.1-EN2.b MTT experiment was conducted to detect the multiplication of SW620 and HT29 cells after the transfection.c Transwell experiment was exploited to detect migration and invasion of SW620 and HT29 cells after the transfection.d Western blot was utilized to detect the EMT markers in SW620 and HT29 cells after the transfection.*P < 0.05, **P < 0.01, and ***P < 0.001.

Figure 6. Graphic abstract: Depletion of circ_0000467 suppressed the malignant phenotypes of CRC cells via modulating the expression levels of miR-382-5p and EN2

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.