Long non-coding RNA SND1-IT1 accelerates cell proliferation, invasion and migration via regulating miR-132-3p/SMAD2 axis in retinoblastoma

Figures & data

Table 1. The primers used in this study for RT-PCR

Names	Sequences (5ʹ-3ʹ)
SND1-IT1: F	ACGCCAGCACATCTGCTGCAC
SND1-IT1: R	GTCGAACGGTCCAGCTCAC
miR-132-3p: F	GCGCGCGTAACAGTCTACAGC
miR-132-3p: R	GTCGTATCCAGTGCAGGGTCC
SMAD2: F	CGTCCATCTTGCCATTCACG
SMAD2: R	CTCAAGCTCATCTAATCGTCCTG
GAPDH: F	GGAGCGAGATCCCTCCAAAAT
GAPDH: R	GGCTGTTGTCATACTTCTCATGG
U6: F	ATTGGAACGATACAGAGAAGATT
U6: R	GGAACGCTTCACGAATTTG

Figure 1. The expression of SND1-IT1 in RB and its clinical significance. (a) SND1-IT1 expression in RB specimens and normal retina tissues was measured using RT-PCR. (b) ROC curves of SND1-IT1 expression for differentiating RB tissues from normal tissue. (c) Relative expression of SND1-IT1 in WERI-RB1, SO-RB50, Y79 and ARPE-19 cells. (d,e) Overall survival rate and disease-free survival rate were calculated using the Kaplan-Meier analysis. **p < 0.01, *p < 0.05

Table 2. Correlations between lncRNA SND1-IT1 and clinicopathological characteristics in retinoblastoma

Variable	Number	SND1-IT1 expression		p value
		High	Low
Age (years)				0.697
<14	53	25	28
≥14	45	23	22
Gender				0.213
Male	55	30	25
Female	43	18	25
Size				0.007
<10 mm	54	25	39
≥10 mm	44	23	11
Choroidal invasion				0.036
Absent	67	28	39
Present	31	20	11
Optic nerve invasion				0.003
Absent	67	26	41
Present	31	22	9
Laterality				0.260
Unilateral	34	14	20
Bilateral	64	34	30

Table 3. Multivariate analyses of prognostic factors in RB patients

Variables	Overall survival			Disease-free survival
	HR	95% CI	p-value	HR	95% CI	p-value
Age	0.893	0.345–1.563	0.432	1.032	0.445–1.344	0.332
Gender	1.228	0.541–1.957	0.391	1.135	0.663–2.231	0.267
Size	3.213	1.345–4.783	0.007	3.432	1.455–5.212	0.002
Choroidal invasion	2.862	1.324–4.387	0.014	2.953	1.452–4.785	0.009
Optic nerve invasion	3.237	1.486–6.478	0.001	3.663	1.568–7.894	0.001
Laterality	1.238	0.548–2.238	0.238	1.428	0.673–2.103	0.339
SND1-IT1 expression	2.986	1.238–4.548	0.013	3.218	1.354–4.896	0.008

Figure 2. SND1-IT1 promoted proliferation of RB cells. (a) qRT-PCR analysis of the effect on inhibition of si-SND1-IT1 transfection in WERI-RB1 and SO-RB50 cell lines. (b) Cell proliferation was determined by CCK-8 assays. (c) Clone formation assays was used to detect cell proliferation in RB cells. (d) EdU immunofluorescence staining assays for WERI-RB1 and SO-RB50 cells. **p < 0.01, *p < 0.05

Figure 3. SND1-IT1 accelerated in vivo tumor growth. (a) The downregulation of SND1-IT1 expression in sh-SND1-IT1 transfected WERI-RB1 cells was confirmed by RT-PCR. (b) Tumors derived from mice in two different groups were presented. (c) Tumor volumes were detected every 7 days. (d) The subcutaneous tumor weights were detected at the 28th day after injection. **p < 0.01, *p < 0.05

Figure 4. Knockdown of SND1-IT1 suppressed the metastasis of RB cells. (a) Wound healing assay was used to assess the migration of WERI-RB1 and SO-RB50 cells transfected with si-SND1-IT1-1, si-SND1-IT1-2 or si-NC, respectively. (b) The effect of SND1-IT1 on WERI-RB1 and SO-RB50 invasion was determined by transwell assays. (c) Knockdown of SND1-IT1 inhibited the EMT progress. **p < 0.01, *p < 0.05

Figure 5. SND1-IT1 acts as a sponge for miR-132-3p. (a) Relative SND1-IT1 expression levels in nuclear and cytosolic fractions of WERI-RB1 and SO-RB50 cells. Nuclear controls: U6; Cytosolic controls: GAPDH. (b) The predicted binding sites of miR-132-3p to the SND1-IT1 sequence. (c) The levels of miR-132-3p in our cohort by RT-PCR. (d) SND1-IT1 expressions in three RB cell lines and ARPE-19 as determined by qRT-PCR. (e) The correlation between miR-132-3p and SND1-IT1 expression analyzed in 98 paired RB samples. (f) CCK-8 determined cell proliferation. (g) Transwell assay was used to detect cell invasion in WERI-RB1 and SO-RB50 cells after overexpression of miR-132-3p. (h) Detection of miR-132-3p using qRT-PCR in the sample pulled down by biotinylated SND1-IT1 probe. (i) Co-transfection of miR-132-3p and SND1-IT1-Wt strongly decreased the luciferase activity. (j,k) The regulatory effects between SND1-IT1 expression and miR-132-3p expression were determined by RT-PCR. **p < 0.01, *p < 0.05

Figure 6. SMAD2 acted as a target of miR-132-3p. (a) The sequences of SMAD2 and miR-132-3p within SMAD2 3ʹ-UTR, including wild-type and mutant. (b) the mRNA and protein levels of SMAD2 were increased in RB cells. (c) Relative luciferase activity of WERI-RB1 and SO-RB50 cells after co-transfection with wild type (wt) or mutant (mut) SMAD2 3ʹ-UTR reporter genes and miR-132-3p mimics. (d) Overexpression of miR-132-3p suppressed the expression of SMAD2. **p < 0.01, *p < 0.05

Figure 7. Knockdown of miR-132-3p attenuates the regulatory effects of SND1-IT1 knockdown on the progression of RB cells. (a) The expression levels of SMAD2 in WERI-RB1 and SO-RB50 cells after knockdown of SND1-IT1 and/or inhibition of miR-132-3p. The CCK-8 assays (b), colony formation assays (c), Cell invasion(d), Edu assays (e) following knockdown of SND1-IT1 and/or inhibition of miR-132-3p. *p < 0.05, **p < 0.01