Phloretin inhibited the pathogenicity and virulence factors against Candida albicans

Figures & data

Table 1. The sequences of primers used in qRT-PCR

Genes	Forward sequences (5ʹ-3ʹ)	Reverse sequences (5ʹ-3ʹ)
EAP1	GGGATGATTACAAGAAAG	GTGACGGTGATGATAGTG
ALS3	CTAATGCTGCTACGTATAATT	CCTGAAATTGACATGTAGCA
HWP1	ACAGGTAGACGGTCAAGG	TGTGGCTGTTGTGGATAG
ECE1	GCTGGTATCATTGCTGATAT	TTCGATGGATTGTTGAACAC
SAP1	TTAGTTATGCTGCTGAC	TGTAAATACCTTTCCCT
SAP2	TTGGATTTGGTGGTGTTT	GTGGCAGCATCTGGAGAA
PLB1	ATACGACGATAACGAAA	TCACCTAATGGCTCACC
GSP1	TGAAGTCCATCCATTAGGAT	ATCTCTATGCCAGTTTGGAA

1. Phloretin inhibited the biofilm formation of C. albicans.

2. Phloretin suppressed the yeast-to-hypha transition of C. albicans.

3. Phloretin repressed the secretion of proteases and phospholipases of C. albicans.

4. Phloretin weakened C. albicans-induced lesions severity of tongue tissues in vivo.

5. Phloretin alleviated C. albicans-induced inflammatory infiltration in vivo.

Figure 1. The antifungal activity of phloretin on Candida albicans. (a) The minimal inhibitory concentration of phloretin that resulted in 80% suppression (MIC) of C. albicans growth. (b) Time-killing curves of C. albicans were measured by CFU counts in the presence of phloretin at 74.55, 149.10, or 298.20 μg/mL (the concentration equivalent to 1×, 2× or 4× MIC). *p < 0.05, **p < 0.01 versus Control

Figure 2. Phloretin inhibited the biofilm formation of Candida albicans. C. albicans (1 × 10⁵ CFU/mL) was treated with 37.28, 74.55, or 149.10 μg/mL (the concentration equivalent to 0.5×, 1× or 2× MIC) phloretin. (a) Calcofluor white staining of C. albicans. Scale bar = 200 μm (b) The membrane permeability of C. albicans was measured by the proportion of live/dead cells. (c) The metabolic activity of C. albicans biofilm exposed to phloretin treatment was evaluated by XTT assay. (d) The biofilm biomass of C. albicans was assessed by crystal-violet biofilm assay. *p < 0.05, **p < 0.01 versus Control

Figure 3. Phloretin suppressed the yeast-to-hyphae transition of Candida albicans. C. albicans (1 × 10⁶ CFU/mL) was treated with 37.28, 74.55, or 149.10 μg/mL (the concentration equivalent to 0.5×, 1× or 2× MIC) phloretin. (a) Representative images of the hyphal formation of C. albicans. Scale bar = 200 μm. The hyphae inhibition rate (%) = (the number of hyphae_control – the number of hyphae_phloretin)/the number of hyphae_control×100%. (b-e) The relative expression of EAP1, ECE1, HWP1, and ALS3. *p < 0.05, **p < 0.01 versus Control

Figure 4. Phloretin attenuated the secretion of Candida albicans protease and phospholipase. C. albicans (1 × 10⁶ CFU/mL) was treated with 37.28, 74.55, or 149.10 μg/mL (the concentration equivalent to 0.5×, 1× or 2× MIC) phloretin. (a) The protease activity of C. albicans. (b) The phospholipase activity of C. albicans. (c-e) The mRNA level of SAP1, SAP2, and PLB1. *p < 0.05, **p < 0.01 versus Control

Figure 5. Phloretin ameliorated the fungal activity in the murine model of oral candidiasis. Mice were sublingually infected with C. albicans suspension (1 × 10⁷ CFU/mL) for 75 min. Topical treatments of phloretin (3.73 or 7.46 mg/mL, which were equivalent to 50× or 100× MIC) were applied twice a day starting on day one post-infection. (a) The score of lesions on the tongue tissues of mice for five days. (b) The CFU counts of C. albicans from the tongue tissues of mice with oral candidiasis. (c) The PAS staining of tongue tissues of mice. Arrows: C. albicans cells. Scale bar = 100 μm. (d) The H&E staining of tongue tissues of mice. Arrows: inflammatory cells. Scale bar = 100 μm. (e-h) The concentration of IL-6, TNF-α, IL-10, and IFN-γ. **p < 0.01 versus Sham; #p < 0.05, ##p < 0.01 versus Oral candidiasis

Data availability statement

The data that support the findings of this study are available from the corresponding author QL upon reasonable request.