MicroRNA miR-497 is closely associated with poor prognosis in patients with cerebral ischemic stroke

Figures & data

Table 1. Primer sequence

	Forward primer (5ʹ-3ʹ)	Reverse primer (5ʹ-3ʹ)
miR-497	ACCCAGAAGACTGTGGATGG	TTCCTTCAGAGCAAACAG-CA
U6	AGGGGAGATTCAGTGTGGTG	GTTGTGCTCAA ATCCCCATT

Figure 1. The flow table for this study

Figure 2. miR-497 expression in CIS. (a) Serum miR-497 expression in CIS patients and health examinees on admission; (b) miR-497 expression in CIS patients on admission and discharge; * P < 0.05. (c) miR-497 expression in four types of CIS patients on admission. * P < 0.05 vs. TIA; # P < 0.05 vs. RIND; @ P < 0.05 vs. SIP. (d) miR-497 expression in four types of CIS patients on discharge

Table 2. Diagnostic significance of miR-497 in CIS by ROC analysis

	CIS	TIA	RIND	SIP	CS
AUC	0.7748	0.6265	0.7578	0.8182	0.8936
Std.Error	0.0554	0.07135	0.06519	0.0582	0.0446
95%CI	0.6662–0.8835	0.4866–0.7663	0.6300–0.8855	0.7041–0.9323	0.8065–0.9807
P	<0.001	0.1032	0.0016	<0.001	<0.001
Cutoff	<4.690	-	<4.685	<3.925	<3.385
Sensitivity (%)	87.64	-	100.0	96.43	100.0
Specificity (%)	66.67	-	66.67	79.49	82.05

Figure 3. Diagnostic significance of miR-497 in CIS. (a) ROC curve of CIS occurrence predicted by miR-497. (b) ROC curve of TIA occurrence predicted by miR-497. (c) ROC curve of RIND occurrence predicted by miR-497. (d) ROC curve of CS occurrence predicted by miR-497. (e) ROC curve of SIE occurrence predicted by miR-497

Figure 4. Correlation of miR-497 with neurological function and oxidative stress in CIS patients. (a) NIHSS scores of CIS patients on admission and discharge; (b) Serum MDA and SOD concentrations of CIS patients on admission and discharge; * P < 0.05. (c) Correlation analysis between miR-497 and NIHSS score in CIS patients on admission; (d) Correlation analysis between miR-497 and MDA concentration in CIS patients on admission; (e) Correlation analysis between miR-497 and SOD concentration in CIS patients on admission

Figure 5. Association between miR-497 and prognosis of CIS patients. (a) miR-497 levels in patients with prognostic death and survival on discharge; * P < 0.05. (b) ROC curve of 3-year death predicted by miR-497 on discharge; (c) 3-year survival curves of patients in high miR-497 group and low miR-497 group; (d) miR-497 levels in patients with and without recurrence on discharge; * P < 0.05. (e) ROC curve of 3-year recurrence predicted by miR-497 on discharge

Figure 6. Impact of elevated miR-497 on CIS rats. (a) miR-497 levels in rat brain tissue in the three series; (b) Water contents of rat brain tissue in the three series; (c) Neuronal apoptosis in rat brain tissue in the three series; * P < 0.05 vs. group A, # P < 0.05 vs. group B