The promotion of cervical cancer progression by signal transducer and activator of transcription 1-induced up-regulation of lncRNA MEOX2-AS1 as a competing endogenous RNA through miR-143-3p/VDAC1 pathway

Figures & data

Table 1. The primers used in this study for RT-PCR

Names	Sequences (5ʹ-3ʹ)
STAT1: F	CAGCTTGACTCAAAATTCCTGGA
STAT1: R	TGAAGATTACGCTTGCTTTTCCT
MEOX2-AS1: F	ACTGCTCTTGCATCCACTCAG
MEOX2-AS1: R	GGCACCTTCAACCTTCACTC
miR-143-3p: F	GGGGTGAGATGAAGCACTG
miR-143-3p: R	CAGTGCGTGTCGTGGAGT
VDAC1: F	ACGTATGCCGATCTTGGCAAA
VDAC1: R	TCAGGCCGTACTCAGTCCATC
GAPDH: F	GGAGCGAGATCCCTCCAAAAT
GAPDH: R	GGCTGTTGTCATACTTCTCATGG
U6: F	TGCGGGTGCTCGCTTCGGCAGC
U6: R	CCAGTGCAGGGTCCGAGGT

Figure 1. The distinct upregulation of MEOX2-AS1 in CC and its clinical significance. (a) The levels of MEOX2-AS1 in 117 patients using RT-PCR. (b) The diagnostic value of MEOX2-AS1 expressions was determined by ROC assays. (c) The comparison of MEOX2-AS1 levels between CC specimens with different stages. (d) The diagnostic value of MEOX2-AS1 for advanced CC specimens. (e)In different CC cell lines, MEOX2-AS1 levels were examined. (f, g) Kaplan-Meier curves for OS and DFS in 117 patients with CC divided based on MEOX2-AS1 expressions. **P < 0.01

Table 2. Clinicopathological features associated with MEOX2-AS1 expression in 117 CC patients

		MEOX2-AS1 expression		P value
Clinicopathological features	Total	High	Low
Age				0.499
<45	64	31	33
≥45	53	29	24
Tumor size (cm)				0.228
<4.0	59	27	32
≥4.0	58	33	25
FIGO stage				0.007
Ib~IIa	76	32	44
IIb~IIIa	41	28	13
Lymph node metastasis				0.012
No	84	37	47
Yes	33	23	10
Depth of cervical invasion				0.017
<2/3	80	35	45
≥2/3	37	25	12

Table 3. Multivariate analysis of overall survival and disease-free survival in 117 patients with CC

Risk factors	Overall survival			Disease-free survival
	HR	95% CI	p	HR	95% CI	p
Age	0.873	0.432–1.467	0.351	0.954	0.556–1.732	0.411
Tumor size	1.013	0.544–1.893	0.432	1.211	0.654–2.033	0.324
FIGO stage	3.113	1.341–5.456	0.003	3.432	1.544–6.432	0.001
Lymph node metastasis	2.893	1.266–4.673	0.006	3.231	1.332–6.763	0.001
Depth of cervical invasion	2.678	1.241–4.545	0.013	2.745	1.327–4.993	0.008
MEOX2-AS1 expression	2.933	1.329–4.673	0.006	3.132	1.344–5.132	0.003

Figure 2. STAT1 activates the transcription of MEOX2-AS1. (a) JASPAR predicted STAT1 binding site prediction in the MEOX2-AS1. we obtained DNA motif of STAT1 and predicted three binding sites of STAT1 in MEOX2-AS1 promoter. (b) The STAT1 expressions in 306 CC specimens and 13 non-tumor cervical specimens from TCGA datasets. (c) The expressions of STAT1 in our cohort. (d) RT-PCR determined STAT1 expressions in different CC cell lines. (e, f) STAT1 and MEOX2-AS1 expressions in CC cells transfected with si-STAT1 or si-NC. (g) Construction of the luciferase reporter vector. (h) Luciferase activity was distinctly decreased in si-STAT1-transfected cells compared with control vector in three binding sites. **P < 0.01, *p < 0.05

Figure 3. Silence of MEOX2-AS1 suppressed the proliferation of CC cells. (a) MEOX2-AS1 expressions in CC cells, transfected with sh-MEOX2-AS1-1, sh-MEOX2-AS1-2 or sh-NC, were tested by qRT-PCR. (b) The proliferative abilities of Hela and SiHa cells were determined through CCK8 assays. (c) Colony formation assays. (d) Tumors from sh-MEOX2-AS1 group and sh-NC group were displayed. (e,f)Volume and weight of tumors obtained were shown. **p < 0.01, ***p < 0.001

Figure 4. Knockdown of MEOX2-AS1 decreases the invasion and migration potential of Hela and SiHa cells. (a) representative images and quantitative analysis of scratch assays, delayed closure was observed in CC cells with MEOX2-AS1 knockdown. (b) Transwell assays demonstrated the anti-invasive ability of sh- MEOX2-AS1-1 and sh-MEOX2-AS1-2. (c) Western blot assays of EMT pathways. **p < 0.01

Figure 5. MEOX2-AS1 acts as a sponge for miR-143-3p. (a) Subcellular fractionation assays for the location of MEOX2-AS1 in SiHa and Hela cells. (b) The prediction of the putative miRNAs targeting MEOX2-AS1 using miRcode and StarBase 3.0. (c,d)RT-PCR for the detection of the miRNA levels in MEOX2-AS1-depleted Hela and SiHa cells. (e) Decreased levels of miRNA-143-3p were observed in CC. (f) RT-PCR confirmed decreased expression of miR-143-3p in four CC cells compared to H8 cells. (g) The diagnostic value of miRNA-143-3p expressions in our cohort. (h) Pearson’s correlation coefficient showed the relationship between miR-143-3p and MEOX2-AS1 in the 117 CC tissues. (i) Schematic outlining the predicted binding sites between MEOX2-AS1 and miR-143-3p. (j) MiR-143-3p mimics promoted the expression of miR-143-3p in Hela and SiHa cells. (k) MiR-143-3p mimics obviously reduced the luciferase activity of MEOX2-AS1-WT. **p < 0.01

Figure 6. VDAC1 was a direct target of miR-143-3p. (a) Schematic construction of WT and Mut 3ʹ-UTR of VDAC1 were displayed. (b) VDAC1 expression in 306 CC tissues and 13 non-tumor samples(TCGA datasets). (c,d) Kaplan-Meier curves for OS and DFS in 292 patients with CC. (e) The expression of VDAC1 in different CC cells. (f,g) Dual luciferase reporter assays demonstrated the functions of miR-143-3p mimics on the activity of the 3ʹUTRs of VDAC1 in Hela and SiHa cells. (h) The levels of MEOX2-AS1 and VDAC1 in Hela cells transfected with miR-NC or miR-143-3p mimics. (i) The levels of MEOX2-AS1 and VDAC1 in Hela cells transfected with NC inhibitors or miR-143-3p inhibitors. ***p < 0.001 **p < 0.01, *p < 0.05

Figure 7. Knockdown of miR-143-3p attenuates the regulatory functions of MEOX2-AS1 silence on the progression of CC cells. (a) The expression levels of VDAC1 in SiHa and Hela cells after knockdown of MEOX2-AS1 and/or inhibition of miR-143-3p. The CCK-8 assays (b), colony formation assays (c), Cell migration(d) and cell invasion assays (e) following knockdown of MEOX2-AS1 and/or inhibition of miR-143-3p. *p < 0.05, **p < 0.01

Data availability statement

All data that support the findings of this study are available from the corresponding authors upon reasonable request.