High-altitude hypoxia exacerbates dextran sulfate sodium (DSS)-induced colitis by upregulating Th1 and Th17 lymphocytes

Figures & data

Table 1. Scores of intestinal tract inflammations

Severity	Score 1	Extent	Score 2
No inflammation	0	No inflammation	0
Mild 10–25%	2	Mucosa	1
Moderate 26–50%	3	Mucosa and submucosa	2
Marked >51%	5	Transmural	3

Table 2. Primers used in this study

Primer	Orientation	Sequence (5ʹ–3ʹ)
GAPDH	F	TGGAATCCTGTGGCATCCATGAAAC
	R	TAAAACGCAGCTAGTAACAGTCCG
IL-17	F	CCACGTCACCCTGGACTCTC
	R	CTCCGCATTGACACAGCG
IFN-γ	F	TCAAGTGGCATAGATGTGGAAGAA
	R	TGGCTCTGCAGGATTTTCATG
TNF-α	F	CCCTCACACTCAGATCATCTTCT
	R	GCTACGACGTGGGCTACAG

Figure 1. High-altitude hypoxia enhances the severity of ulcerative colitis in the DSS induced colitis mice model, 5 mice /group were used. (a) The effect of high-altitude hypoxia on the body weight during 8 days among groups (NC, normal group; ND, DSS group; HC, Hypobaric hypoxia group; HD, hypobaric hypoxia DSS group). (b) The effect of high-altitude hypoxia during 3 months among tested groups. (c) the results of disease active index among tested groups. (d, e) The length of colon among tested groups. *P < 0.05, **P < 0.01, ***P < 0.001

Figure 2. HAH showed significant damage of colon epithelial layer and activation of myeloperoxidase (MPO) in the DSS induced colitis model, 5 mice /group were used to test: (a) HE histology presented the damage of epithelial layer as pointed by red arrow; (b) the score of histological inflammation of colon among animal tested groups; (c) MPO activity scores among tested groups. *P < 0.05, **P < 0.01 ***P < 0.001

Figure 3. Effect of high-altitude hypoxia on the spleen and MLN cytokines. Splenocytes and MLN were detached freshly (5 × 10⁶) from BALB/c mice (5 mice /group) and cultivated in the presence of anti-CD3+ antibodies for 72 h, and then ELISA was used to measure IL-17, IFN-γ, IL-10, and TNF-α levels. (a, b) The levels of TNF-α in the spleen and MLNs respectively. (c, d) The levels of IL-17 in the spleen and MLNs respectively. (e, f) The levels of IFN-γ in the spleen and MLNs respectively. (g, h) the levels of IL-10 in the spleen and MLNs respectively. *P < 0.05, **P < 0.01, ***P < 0.001

Figure 4. The gene expression changes of inflammatory cytokines in the colon tissue collected from four tested groups (5 mice /group) showed increased inflammatory cytokines in the colon tissue. (a) The expression changes of TNF-α in the four tested groups. (b) The expression changes of INF-γ in the four tested groups. (c) The expression changes of IL-17 in the four tested groups. **P < 0.01 ***P < 0.001

Figure 5. HAH significantly increases the percentage of infiltrating CD4+ IFN-γ+ cells and CD4+ IL-17+ cells in the DSS induces colitis groups compared to other tested groups, 5 mice /group were used in this analysis. (a) The percentage of CD4+ IFN-γ+ and CD4+ IL-17+ lymphocytes in the spleen and MLNs samples of all tested groups. (b) The population of CD4+ IFN-γ+ in the all tested groups. (c) the population of CD4+ IL-17+ in the all tested groups

Data availability statement

Authors declare that all data belong to this manuscript have been included in the manuscript more details are available by sending email to the corresponding author. https://www.jianguoyun.com/p/DYhkB-8Q1_zuCRiSzJAE; https://www.jianguoyun.com/p/DYBfWIMQ1_zuCRiUzJAE; https://www.jianguoyun.com/p/DeYcqxcQ1_zuCRiMzJAE