LETM1 (leucine zipper-EF-hand-containing transmembrane protein 1) silence reduces the proliferation, invasion, migration and angiogenesis in esophageal squamous cell carcinoma via KIF14 (kinesin family member 14)

Figures & data

Table 1. List of specific primer pairs for target and reference genes for RT-qPCR analysis

Gene	Primer name	Sequence 5ʹ-3’
LETM1	Forward	CCGAGTGCCTTCGCATAGTG
	Reverse	ACTTCTCTACTACCGAGTCATCG
KIF14	Forward	CCTCACCCACAGTAGCCGA
	Reverse	AAGTGCCAATCTACCTACAGGA
U6	Forward	AAAGCAAATCATCGGACGACC
	Reverse	GTACAACACATTGTTTCCTCGGA

Figure 1. The expression of LETM1 in ESCC cells. (a) The mRNA expression of LETM1 in ESCC cells; (b) The protein expression of LETM1 in ESCC cells. ***P < 0.001 vs. Het-1A

Figure 2. The results of cell proliferation, invasion and migration in ESCC. (a) The mRNA expression of LETM1 in transfected cells; (b) The protein expression of LETM1 in transfected cells; (c) The result of ESCC cell proliferation; (d) The result of wound healing assay in ESCC cells; (e) The result of transwell assay in ESCC cells; (f) The results of cell invasion and migration-related protein expression. **P < 0.01, ***P < 0.001 vs. siRNA-NC

Figure 3. The results of angiogenesis in ESCC. (a) The pictures of tube formation; (b) The related protein expression of tube formation. ***P < 0.001 vs. siRNA-NC

Figure 4. LETM1 in conjunction with KIF14 in ESCC cells. The (a) mRNA and (b) protein expression of KIF14 in ESCC cells, ***P < 0.001 vs. Het-1A; (c-d) The results of CoIP assay; The (e) mRNA and (f) protein expression of KIF14 in transfected cells, ***P < 0.001 vs. siRNA-NC

Figure 5. The results of cell proliferation, invasion and migration in ESCC affected by LETM1 and KIF14. The (a) mRNA and (b) protein expression of KIF14 in transfected cells, *P < 0.05, ***P < 0.001 vs. Ov-NC; (c) The result of ESCC cell proliferation; (d) The result of wound healing assay in ESCC cells; (e) The result of transwell assay in ESCC cells; (f) The results of cell invasion and migration-related protein expression. ***P < 0.001 vs. control; ^##P < 0.01, ^###P < 0.001 vs. siRNA-LETM1+ Ov-NC

Figure 6. The results of angiogenesis in ESCC effected by LETM1 and KIF14. (a) The pictures of tube formation; (b) The related protein expression of tube formation. ***P < 0.001 vs. control; ^##P < 0.01, ^###P < 0.001 vs. siRNA-LETM1+ Ov-NC