Pathogenic mechanisms of preeclampsia with severe features implied by the plasma exosomal mirna profile

Figures & data

Table 1. Studies profiling the plasma exosomal miRNAs of patients with preeclampsia. PE: preeclampsia, EOPE: early onset preeclampsia, LOPE: late onset preeclampsia

Literatures	Group design	Detection method	Main findings
Salomon et al. (2017) [14]	PE vs. normal	Next-generation sequencing	Identified 12 differentially expressed serum exosomal miRNAs between normal group and PE group.
Pillay et al. (2019) [15]	EOPE/LOPE vs. normal	Next-generation sequencing	Identified differentially expressed serum exosomal miRNAs in early and late onset preeclampsia, such as miR-3605-3p and miR-122-5p.
Devor et al. (2020) [16]	PE vs. normal	TaqMan Low Density microRNA Arrays (TLDA)	Detected exosomal miRNAs profiles in each trimester of pregnancy, provided biomarkers of predictive value for preeclampsia.
Li et al. (2020) [17]	PE vs. normal	qPCR-based TaqMan Advanced miRNA assay	Found 7 miRNA species were differentially expressed in serum exosomes from women with preeclampsia and those from controls.

Table 2. Clinical characteristics of enrolled patients. *: p-value<0.05. ALT: alanine aminotransferase; AST: aspartate aminotransferase

	control(n=3)	sPE(n=3)
Age (y)	29.67±1.70	28.67±2.05
Body mass index(kg/m^2)	25.30±2.36	24.78±2.19
Gestational week (weeks)	39.00±0.82	33.33±2.36
Systolic pressure(mmHg)	125.00±4.08	163.33±4.71*
Diastolic pressure(mmHg)	71.67±6.24	112.67±12.28*
ALT (U/L)	24.33±13.70	269.00±347.20
AST (U/L)	23.33±5.56	227.67±288.74
Platelet (10^9/L)	203.67±43.28	133.33±2.62
Proteinuria positive ratio (%)	0	100
Apgar score at1min	9±0	7±0.82
Neonatal birth weight (g)	3150.00±294.40	1766.67±572.03*

Table 3. Differentially expressed plasma exosomal miRNAs

miRNA	log2FoldChange	P-value	Sequence (5ʹ to 3ʹ)
hsa-miR-125a-3p	-2.909723858	0.023170976	ACAGGTGAGGTTCTTGGGAGCC
hsa-miR-125b-5p	2.360338783	0.025220126	TCCCTGAGACCCTAACTTGTGA
hsa-miR-148a-5p	-3.297554546	0.004103378	AAAGTTCTGAGACACTCCGACT
hsa-miR-155-5p	3.443051698	0.001495107	TTAATGCTAATCGTGATAGGGGTT
hsa-miR-17-5p	2.987587066	0.012174407	CAAAGTGCTTACAGTGCAGGTAG
hsa-miR-193b-5p	-2.977244619	0.028855453	CGGGGTTTTGAGGGCGAGATGA
hsa-miR-195-3p	-3.45566586	0.018709016	CCAATATTGGCTGTGCTGCTCC
hsa-miR-199a-5p	2.186004643	0.017650947	CCCAGTGTTCAGACTACCTGTTC
hsa-miR-200c-3p	5.480264965	8.13E-05	TAATACTGCCGGGTAATGATGGA
hsa-miR-203a-3p	3.841681468	0.005200292	GTGAAATGTTTAGGACCACTAG
hsa-miR-205-5p	3.838203786	0.009743346	TCCTTCATTCCACCGGAGTCTG
hsa-miR-206	-3.311518297	0.008274703	TGGAATGTAAGGAAGTGTGTGG
hsa-miR-2110	-5.070758573	0.000654162	TTGGGGAAACGGCCGCTGAGTG
hsa-miR-215-5p	4.459820445	0.001085737	ATGACCTATGAATTGACAGAC
hsa-miR-328-3p	3.34533119	0.033574838	CTGGCCCTCTCTGCCCTTCCGT
hsa-miR-331-5p	-5.205950072	0.000989231	CTAGGTATGGTCCCAGGGATCC
hsa-miR-335-5p	-2.109330178	0.0415164	TCAAGAGCAATAACGAAAAATGT
hsa-miR-340-5p	2.366380449	0.048545552	TTATAAAGCAATGAGACTGATT
hsa-miR-370-3p	3.254431927	0.00836901	GCCTGCTGGGGTGGAACCTGGT
hsa-miR-483-5p	3.447628353	0.0109226	AAGACGGGAGGAAAGAAGGGAG
hsa-miR-500a-3p	-2.480551744	0.034688244	ATGCACCTGGGCAAGGATTCTG
hsa-miR-509-3p	2.596975968	0.031922797	TGATTGGTACGTCTGTGGGTAG
hsa-miR-518b	3.306397487	0.012835174	CAAAGCGCTCCCCTTTAGAGGT
hsa-miR-543	-2.165628912	0.032301788	AAACATTCGCGGTGCACTTCTT
hsa-miR-548o-3p	3.342808425	0.016714456	CCAAAACTGCAGTTACTTTTGC
hsa-miR-654-5p	-2.300317719	0.026300428	TGGTGGGCCGCAGAACATGTGC
hsa-miR-660-5p	-5.685021088	0.000117126	TACCCATTGCATATCGGAGTTG
hsa-miR-744-5p	-2.70869948	0.04381084	TGCGGGGCTAGGGCTAACAGCA
hsa-miR-9985	-3.609719989	0.002649267	TTCACAGTGGCTAAGCTAT

Figure 1. Identification of isolated plasma exosomes. (a) TEM of exosomes. black arrow: exosomes. (b) particle diameters distribution of exosomes. (c) western blot of exosomal markers

Figure 2. Differentially expression analysis. (a) volcano plot of differentially expressed miRNAs. (b) heat map of differentially expressed miRNAs

Figure 3. Gene set enrichment analysis. (a) gene ontology analysis of differentially expressed miRNAs. The left part of bar shows enrichment result about DEMirs, the right part shows top 10 enriched categories about UEMirs. (b) KEGG pathway analysis of UEMirs. Top 30 pathway terms were selected according to adjust p-value

Figure 4. Two interested KEGG pathways. (a) AMPK signaling pathway. (b) insulin signaling pathway. The nodes highlighted in red indicate targets of UEMirs

Salomon C, Guanzon D, Scholz-Romero K, et al. Placental exosomes as early biomarker of preeclampsia: potential role of exosomal micrornas across gestation. J Clin Endocrinol Metab. 2017;102:3182–3194.

 PubMed Web of Science ®Google Scholar

Pillay P, Vatish M, Duarte R, et al. Exosomal microrna profiling in early and late onset preeclamptic pregnant women reflects pathophysiology. Int J Nanomedicine. 2019;14:5637–5657.

 PubMed Web of Science ®Google Scholar

Devor E, Santillan D, Scroggins S, et al. Trimester-specific plasma exosome microrna expression profiles in preeclampsia. J Matern Fetal Neonatal Med. 2020;33:3116–3124.

 PubMed Web of Science ®Google Scholar

Li H, Ouyang Y, Sadovsky E, et al. Unique microrna signals in plasma exosomes from pregnancies complicated by preeclampsia. Hypertension. 2020;75:762-771.

 Web of Science ®Google Scholar