The landscape of DNA methylation in asthma: a data mining and validation

Figures & data

Table 1. Primer for MSP-PCR

Name	Forward Primer (5ʹ-3ʹ)	Reverse Primer (5ʹ-3ʹ)
HLA-DMB (M)	AAATTTGTTTTTTTAAGATATATACGT	CAACAATATATAAACCTTCCGTT
HLA-DMB(UM)	TAAATTAAAATTATAATGAGATATTGT	ACCAACAATATATAAACCTTCCATT

M: methylation; UM: un-methylation.

Figure 1. DNA methylation in asthma. (a) The distribution of differential methylation sites on chromosomes; (b) Frequency of hypermethylation and hypomethylation on each chromosome; (c) Clustering heat map of methylation difference sites

Table 2. Distribution of methylation on each chromosome

Chr	Length	Hyper/Mb	Hypo/Mb	CpG/Mb	Hyper/Hypo ratio
chr1	249.25	0.02	0.62	0.64	31.00
chr2	243.20	0.12	1.30	1.42	10.93
chr3	198.02	0.16	2.49	2.65	15.41
chr4	191.15	0.13	1.60	1.73	12.20
chr5	180.92	0.17	2.16	2.33	12.61
chr6	171.12	0.20	3.64	3.84	18.32
chr7	159.14	0.22	3.22	3.44	14.66
chr8	146.36	0.15	2.75	2.90	18.27
chr9	141.21	0.06	1.90	1.96	29.78
chr10	135.53	0.28	3.39	3.67	12.08
chr11	135.01	0.21	4.61	4.82	21.45
chr12	133.85	0.31	3.45	3.76	11.27
chr13	115.17	0.04	1.38	1.42	31.80
chr14	107.35	0.17	3.34	3.51	19.94
chr15	102.53	0.17	2.74	2.91	16.53
chr16	90.35	0.22	6.51	6.73	29.40
chr17	81.20	0.36	8.97	9.32	25.10
chr18	78.08	0.06	1.06	1.13	16.60
chr19	59.13	0.37	6.65	7.02	17.86
chr20	63.03	0.10	3.70	3.79	38.83
chr21	48.13	0.08	1.75	1.83	21.00
chr22	51.30	0.06	3.92	3.98	67.00

Figure 2. Differential genes in asthma. (a) Volcano map of differential genes; (b) The relationship between DNA methylation differences and expression of differential genes. The blue dots indicate that the fold change of gene expression was greater than 2, and the average difference of methylation sites was greater than 0.3. The red dots indicate the sites with statistical differences

Figure 3. Analysis of the correlation between DNA methylation sites and gene expression. (a) Cumulative ratio of gene expression variation; (b) Beta size histogram distribution; (c) Interpreted histogram distribution of gene expression variation

Figure 4. GO annotation and KEGG analysis. (a) Gene function annotation analysis; (b) KEGG pathway analysis; (c) Expression correlation between cg04933135 and HLA-DMB; (d) The expression level of HLA-DMB mRNA was detected in the blood samples of asthma patients and healthy volunteers by RT-qPCR

Data availability statement

The data used to support the findings of this study are available from the corresponding author ([email protected]) upon request.