MicroRNA miR-18a-3p promotes osteoporosis and possibly contributes to spinal fracture by inhibiting the glutamate AMPA receptor subunit 1 gene (GRIA1)

Figures & data

Table 1. The characteristics of the clinical samples used in this study

	Control	Osteoporosis patients without spinal fracture	Osteoporosis patients with spinal fracture
Included patients (n)	40	40	40
Age (years), mean (range)	52.4 (18–77)	68.3 (46–83)	72.6 (57–85)
Sex
Male, n (%)	19 (47.5)	13 (32.5)	8 (20.0)
Female, n (%)	21 (52.5)	27 (67.5)	32 (80.0)
Body mass index (± SD)	22.7 ± 3.04	30.5 ± 4.63	31. 8 ± 5.79
Main diagnosis	Healthy control	Osteoporosis patients without spinal vertebral	Osteoporosis patients with spinal vertebral
Bone density (T-score) ± SD	0.17 ± 0.73	−2.48 ± 0.28	−2.69 ± 0.76

Table 2. Sequence of the primers used in this study

Gene name	Sequence (5ʹ-3ʹ)
miR-18a-3p①	Forward:CGACTACTGCCCTAAGTGCTC
	Reverse:GTGCAGGGTCCGAGGTATTC
U6①	Forward:CTC GCTTCGGCAGCACA
	Reverse:AACGCTTCA CGAATTTGCGT
GRIA1②	Forward:GCCAATGTAAAAAGGAATA
	Reverse:AACAGAAACGGTAAGTCATC
GAPDH③	Forward:TGTTCGTCATGGGTGTGAAC
	Reverse:GTCTTCTGGGTGGCAGTGAT
ALP③	Forward:TGCAGTACGAGCTGAACAGG
	Reverse:GTCAATTCTGCCTCCTTCCA
RUNX2④	Forward:GCCTTCAAGGTGGTAGCCC
	Reverse:AAGGTGAAACTCTTGCCTCGTC
OCN③	Forward:GGCAGCGAGGTAGTGAAGA
	Reverse:TCAGCCAACTCGTCACAGTC
OPN③	Forward:TCAGCTGGATGACCAGAGTG
	Reverse:TTGGGGTCTACAACCAGCAT

Figure 1. MiR-18a-3p is associated with OP and osteogenic differentiation (a) miR-18a-3p expression level in OP-no-Frt and OP-Frt was determined through qRT-PCR. **P < 0.001. (b) miR-18a-3p expression level in hBMSCs osteogenesis was detected via qRT-PCR. (c) ALP activity of cells described in hBMSCs osteogenesis. (d) Osteogenesis related genes ALP was detected in hBMSCs osteogenesis by qRT-PCR. (e) ARS was applied to quantify the bone mineralization ability of hBMSCs. (f-h) Osteogenesis related genes RUNX2 (f), OCN (g) and OPN (h) were detected in hBMSCs osteogenesis by qRT-PCR. (i). ELISA analysis of OCN expression in culture medium at different time. (j) Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis.*P < 0.05 vs. 0 day; **P < 0.001 vs. 0 day.

Figure 2. The low expression of miR-18a-3p promotes osteogenic differentiation, while overexpression of miR-18a-3p inhibits osteogenic differentiation. (a) miR-18a-3p level was determined by qRT-PCR in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (b) Cell viability of hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic was measured by CCK-8 assay. (c) ALP activity of cells described in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (d) Osteogenesis related genes ALP was detected in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic by qRT-PCR. (e) ARS was applied to quantify the bone mineralization ability of hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (f-h) Osteogenesis related genes RUNX2 (f), OCN (g) and OPN (h) were detected in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic by qRT-PCR. (i) ELISA analysis of OCN expression in culture medium of different groups. (j). Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis in different groups. *P < 0.05, **P < 0.001 vs. blank.

Figure 3. GRIA1 is a target mRNA of miR-18a-3p. (a) Schematic picture of miR-18a-3p and GRIA1 3ʹ-UTR. (b) Luciferase activity were detected in hBMSCs containing WT or mutated GRIA1 3ʹ-UTR and transfected with miR-18a-3p mimic or mimic NC. **P < 0.001 vs. miR-NC. (c) RNA pull-down was used to validate the enrichment of GRIA1 in miR-18a-3p. **P < 0.001 vs. Bio-NC. (d) GRIA1 expression level in OP-no-Frt and OP-Frt was determined through qRT-PCR. **P < 0.001. (e) The correlation of miR-18a-3p and GRIA1 in OP-no-Frt was analysis by Pearson. (f) The correlation of miR-18a-3p and GRIA1 in OP-Frt was analysis by Pearson. (g) GRIA1 expression level in hBMSCs osteogenesis was detected via qRT-PCR. **P < 0.001 vs. 0 day. (h) GRIA1 expression level in hBMSCs osteogenesis was detected via Western blot. *P < 0.05, **P < 0.001 vs. 0 day. (i) GRIA1 expression level was determined by qRT-PCR in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. *P < 0.05, **P < 0.001 vs. blank. (j) GRIA1 expression level was determined by Western blot in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic as indicated. *P < 0.05, **P < 0.001 vs. blank.

Figure 4. miR-18a-3p controls osteogenic differentiation through GRIA1. (a) GRIA1 expression level was determined by qRT-PCR in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (b) GRIA1 expression level was determined by Western blot in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (c) Cell viability of hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 was measured by CCK-8 assay. (d) ALP activity of cells described in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (e) Osteogenesis related genes ALP was detected in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 by qRT-PCR. (f) ARS was applied to quantify the bone mineralization ability of hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (g-i) Osteogenesis related genes RUNX2 (g), OCN (h) and OPN (i) were detected in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 by qRT-PCR. (j). the osteogenic marker OCN was detected by ELISA. (k). Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis in different groups. *P < 0.05, **P < 0.001 vs. blank.##P < 0.05, ##P < 0.001 vs. mimic + OE.