Inhibition of integrin subunit alpha 11 restrains gastric cancer progression through phosphatidylinositol 3-kinase/Akt pathway

Figures & data

Table 1. Relationship between the ITGA11 expression in GC tissue samples and clinical characteristics

Characteristics	Patients	Expression of ITGA11		P-value
		High- ITGA11	Low-ITGA11
Total	49	27	22
Age(years)				0.897
<63	25	14	11
≥63	24	13	11
Gender				0.335
Male	26	16	10
Female	23	11	12
Tumor location				0.659
Bottom	21	13	8
Body	15	8	7
Gastric antrum	13	6	7
Diameter				0.013*
<3 cm	26	10	16
≥3 cm	23	17	6
Clinical stage				0.030*
Early	24	17	7
Middle and late	25	10	15
Distant metastasis				0.030*
Without	25	10	15
With	24	17	7
Vascular invasion				0.038*
Yes	28	19	9
No	21	8	13

(Note: *P < 0.05 was statistically significant)

Table 2. Primer sequences

Gene name	Primer sequences (5`→3`)
ITGA11	forward: GCAGTGACAGTAATGAGCGG reverse: TGAAGATGCAGCTGAAGGGA
β-actin	forward: GGCATCCTCACCCTGAAGTA reverse: GAAGGTGTGGTGCCAGATTT

Figure 1. Expression of ITGA11 in GC

A: The ITGA11 profile in cancerous and paracancerous normal tissues of 49 clinical samples was examined by qRT-PCR. B: The ITGA11 profile in five cases of cancerous and paracancerous GC tissues was verified by WB. C: The GEPIA database was adopted to verify ITGA11 expression in GC tissue. D: The effect of ITGA11 on the GC prognosis was analyzed in the human protein altas (https://www.proteinatlas.org/). E. Kaplan-Meier Plotter database (http://kmplot.com/analysis/) was adopted for analyzing the association of ITGA11 levels with overall survival, first progression and post progression survival of GC sufferers. **P < 0.01, ***P < 0.001

Figure 2. Inhibiting ITGA11 attenuated GC cell proliferation and invasion and strengthened apoptosis

ITGA11 knockdown models were constructed in MKN45 and AGS cells. A-B: qRT-PCR and WB were implemented to test the effect of ITGA11 knockdown plasmids. C-D: Cell proliferation was verified by CCK-8 and colony formation experiment. E-F: The migrative and invasive ability of MKN45 and AGS were monitored by Transwell assay. G: The profiles of Bcl-2, Bad, C-Caspase3 and Bax were monitored by WB. H: TUNEL assay was adopted to gauge the apoptosis of MKN45 and AGS cells. Ns P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001. N = 3

Figure 3. The regulatory effect of ITGA11 on the ITGA11/ PI3K/AKT pathway

LinkedOmics database (http://linkedomics.org/login.php) was used for analyzing the potential downstream targets of ITGA11. A: The positively and negatively co-expressed Top-50 genes of ITGA11 in GC were displayed in heat maps. B: The overall closely co-expressed genes of ITGA11 in GC were exhibited as a volcano plot. C-D: PI3K-AKT pathway has a potential role in ITGA11 in GC. The data was analyzed by GSEA. E-I: The LinkedOmics database analyzed the correlation between ITGA11 and PIK3CG, PIK3CD, PIK3CA, AKT2, and AKT3

Figure 4. Inhibiting ITGA11 inactivated PI3K/AKT

ITGA11 knockdown models were established in MKN45 and AGS. A-B. WB was applied to make certain the PI3K/AKT profile in MKN45 and AGS cells. * * * P < 0.001, N = 3

Figure 5. Activating PI3K repressed the effect of ITGA11 knockdown on GC progression

ITGA11 knockdown plasmids and/or IGF-1 were added to MKN45 cells. A-B: The CCK-8 assay and colony formation test were carried out to gauge cell proliferation. C-D: Cell migration and invasion were assessed by Transwell assay. E: The profiles of Bcl-2 and Bax were monitored by WB. F: WB gauged the protein levels of the PI3K/AKT axis in MKN45 cells. * P < 0.05, * * P < 0.01, * * * P < 0.001, N = 3

Figure 6. Knocking down ITGA11 dampened GC cell growth cells in vivo.

Mouse tumor models knocking down ITGA11 were constructed in MKN45 and AGS cell lines. A: Analysis of survival rates in mice. B-G: After 30 days, the nude mice were sacrificed, and their subcutaneous nodules were removed, with tumor volume and weight calculated. H: The TUNEL assay was employed to examine apoptosis in tumor tissues. I: The fluorescence intensity of the PI3K/AKT pathway was checked by tissue immunofluorescence. J: The profiles of ITGA11 and PI3K/AKT were tested by WB. * * * P < 0.001, N = 5