Diagnostic significance of microRNA-1255b-5p in prostate cancer patients and its effect on cancer cell function

Figures & data

Table 1. Clinicopathological characteristics of prostate cancer patients and association with miR-1255b-5p expression

Variables	Number (n = 153)	miR-1255b-5p expression		P
		Low (n = 66)	High (n = 87)
Prostate-specific antigen (ng/mL)	median value = 5.62 (2.02–20.49)
Age (Years)				0.792
< 63	83	35	48
≥ 63	70	31	39
Gleason score at diagnosis				0.002
6	105	54	51
7	48	12	36
Tumor stage				0.016
I	132	62	70
II	21	4	17
Smoking statue
Nonsmoker	64	27	37	0.841
Smoker	89	39	50
Family history of prostate cancer
No	143	60	83	0.265
Yes	10	6	4
Positive cores (n)
<10	82	43	39	0.13
≥10	71	23	48

Table 2. Primers sequence

Primer name	Sequence 5′ → 3′
miR‐1255b‐5p	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACCACTT (stem‐loop primer)
	GGGCGGATGAGCAAAGA (forward)
	AACTGGTGTCGTGGAGTCGGC (reverse)
U6	CTCGCTTCGGCAGCACA (forward)
	AACGCTTCACGAATTTGCGT (reverse)
EPB41L1	AGGAAACCACGCCGAGACACAA (forward)
	GGTGGATGAGTTTGCTGTTGGG (reverse)
GAPDH	GGAGCGAGATCCCTCCAAAAT (forward)
	GGCTGTTGTCATACTTCTCATGG (reverse)

Figure 1. miR-1255b-5p presented an increased level in the blood samples from low-risk prostate cancer and cancer cell lines. A. The expression of miR-1255b-5p in blood from low-risk prostate cancer (PCa) patients and benign prostatic hyperplasia (BPH). B. The level of miR-1255b-5p in blood from indolent population and upgrading population. C. The level of miR-1255b-5p in prostate cell lines (RWPE-1, RWPE-2, 22Rv1, LNCaP, PC-3, and DU145). ***P < 0.001

Figure 2. Receiver operating characteristic (ROC) curve analyses corresponds to miR-1255b-5p expression levels. A. ROC curve to discriminate low-risk prostate cancer patients from benign prostatic hyperplasia (BPH) individuals. B. ROC curve to discriminate upgrading prostate cancer from indolent ones

Figure 3. EPB41L1 3ʹUTR is targeted by miR-1255b-5p. A. The binding sites at EPB41L1 3ʹUTR with miR-1255b-5p. B. The dual-luciferase reporter assay verified the binding relationship between EPB41L1 3ʹUTR and miR-1255b-5p. C. The relative expression level of EPB41L1 mRNA was reduced in blood from low-risk prostate cancer (PCa) patients compared with that from benign prostatic hyperplasia (BPH) by qRT-PCR. D. The relative expression level of EPB41L1 mRNA in prostate cell lines (RWPE-1, RWPE-2, 22Rv1, LNCaP, PC-3, and DU145) by qRT-PCR. E. The negative correlation between the level of miR-1255b-5p and EPB41L1 mRNA expression

Figure 4. Downregulation of miR-1255b-5p inhibited the cell migration and invasion in prostate cancer cells (22Rv1 and DU145), however, these effects can be reversed by EPB41L1 inhibition. A and B. The transfection was successful. C and D. CCK-8 assay for cell proliferation. E and F. Transwell assay for cell migration. G and H Transwell assay for cell invasion. **P < 0.01, ***P < 0.001. &P < 0.05, &&P < 0.01, &&&P < 0.001