Circular RNA expression alteration and bioinformatics analysis in patients with acute cerebral infarction injury

Figures & data

Table 1. Top 10 upregulated and downregulated circRNAs ranked by fold changes after SCI

circRNA	FC (abs)	P-value	FDR	chrom	chrom	strand	circRNA_type	best_transcript	GeneSymbol	GeneSymbol	Regulation
hsa_circRNA_103372	21.04715	0.034768	0.195768	chr3	chr3	-	exonic	NM_016291	IP6K2	IP6K2	up
hsa_circRNA_405965	16.28764	0.012321	0.129885	chr2	chr2	-	exonic	ENST00000392929	CCNT2-AS1	CCNT2-AS1	up
hsa_circRNA_103948	13.66356	0.037862	0.204714	chr5	chr5	+	exonic	NM_021982	SEC24A	SEC24A	up
hsa_circRNA_000102	12.03363	0.012049	0.128922	chr1	chr1	-	intronic	ENST00000357393	AKNAD1	AKNAD1	up
hsa_circRNA_001691	11.66992	0.027711	0.176117	chr7	chr7	-	exonic	NM_002137	HNRNPA2B1	HNRNPA2B1	up
hsa_circRNA_405641	11.58714	0.038655	0.206399	chr17	chr17	-	intronic	ENST00000269392	AZI1	AZI1	up
hsa_circRNA_104939	11.54522	0.04101	0.213631	chr9	chr9	+	exonic	NM_005157	ABL1	ABL1	up
hsa_circRNA_074559	10.41267	0.03915	0.207731	chr5	chr5	-	exonic	NM_016221	DCTN4	DCTN4	up
hsa_circRNA_008389	10.07535	0.012801	0.131943	chr1	chr1	-	exonic	NM_018198	DNAJC11	DNAJC11	up
hsa_circRNA_019744	8.532438	0.039087	0.207485	chr10	chr10	-	exonic	NM_005736	ACTR1A	ACTR1A	up
hsa_circRNA_103887	20.1334	0.00224	0.089408	chr5	chr5	+	exonic	NM_138782	FCHO2	FCHO2	down
hsa_circRNA_101836	19.86489	0.021279	0.159215	chr16	chr16	+	exonic	NM_004555	NFATC3	NFATC3	down
hsa_circRNA_406791	18.30178	0.001674	0.088954	chr6	chr6	+	exonic	NM_015555	ZNF451	ZNF451	down
hsa_circRNA_102995	18.21764	0.004734	0.098011	chr20	chr20	+	exonic	NM_019095	CRLS1	CRLS1	down
hsa_circRNA_102183	16.39273	0.003117	0.092018	chr17	chr17	+	exonic	NM_004459	BPTF	BPTF	down
hsa_circRNA_000581	16.28442	0.001974	0.088954	chr14	chr14	+	exonic	NR_038354	WDR20	WDR20	down
hsa_circRNA_101837	16.22925	0.022342	0.160614	chr16	chr16	+	exonic	NM_004555	NFATC3	NFATC3	down
hsa_circRNA_103572	16.15558	0.010143	0.121564	chr3	chr3	+	exonic	uc003fyk.2	LRCH3	LRCH3	down
hsa_circRNA_101771	14.87513	0.004531	0.097171	chr16	chr16	+	exonic	NM_014494	TNRC6A	TNRC6A	down
hsa_circRNA_092476	14.86703	0.003553	0.092018	chr19	chr19	-	exonic	ENST00000596831	AC004076.9	AC004076.9	down

Figure 1. Hierarchical clustering of circRNAs expression. C1/3/4 refers to the peripheral blood samples of sham control group, and T1/2/4 refers to the peripheral blood samples of SCI group. (a) Hierarchical cluster analysis included 13,279 circRNAs in ACI group and sham control group. (b) Hierarchical cluster analysis includes differentially expressed circRNAs (P < 0.05; folding change≥2). There was significant difference between ACI group and sham operation group

Figure 2. Difference of expression profiles of circRNAs between two groups. (a) Scatter plot show the difference of circRNAs expression between sham operation group and ACI group. The x-axis and y-axis values in the scatter plot are the normalized signal values of samples (log-2 scale) or the average normalized signal values of sample groups (log-2 scale). The green line is the fold change line. The circRNAs above and below the green line represent those circRNAs which show at least 2-fold changes in expression. (b) Volcano map show that cyclic ribonucleic acid was differentially expressed with statistical significance (P < 0.05; folding change ≥ 2). (c) The distribution of circRNAs indicated that the dysregulated circRNAs originated from each chromosome. (d) The classification bar chart of circRNAs based on gene source shows that most cyclic ribonucleic acids changed after ACI are exons

Table 2. The five highest-ranking miRNA candidates for top 10 upregulated and downregulated circRNAs

circRNA	Predicted miRNA response elements (MREs)
	MRE1	MRE2	MRE3	MRE4	MRE5
hsa_circRNA_103372	hsa-miR-494-5p	hsa-miR-577	hsa-miR-628-5p	hsa-miR-647	hsa-miR-526b-5p
hsa_circRNA_405965	hsa-miR-4298	hsa-miR-3714	hsa-miR-6072	hsa-miR-6768-3p	hsa-miR-519d-5p
hsa_circRNA_103948	hsa-miR-421	hsa-miR-181a-2-3p	hsa-miR-505-3p	hsa-miR-429	hsa-miR-380-5p
hsa_circRNA_000102	hsa-miR-1296-3p	hsa-miR-194-3p	hsa-miR-3184-3p	hsa-miR-4753-3p	hsa-miR-412-3p
hsa_circRNA_001691	hsa-miR-5193	hsa-miR-6792-3p	hsa-miR-4691-5p	hsa-miR-6509-3p	hsa-miR-4776-3p
hsa_circRNA_405641	hsa-miR-6808-5p	hsa-miR-6764-5p	hsa-miR-4323	hsa-miR-6856-5p	hsa-miR-2861
hsa_circRNA_104939	hsa-miR-193b-3p	hsa-miR-194-3p	hsa-miR-762	hsa-miR-486-5p	hsa-miR-892b
hsa_circRNA_074559	hsa-miR-3942-5p	hsa-miR-4682	hsa-miR-7-2-3p	hsa-miR-8076	hsa-miR-4703-5p
hsa_circRNA_008389	hsa-miR-7111-3p	hsa-miR-6873-3p	hsa-miR-6769b-3p	hsa-miR-760	hsa-miR-1236-3p
hsa_circRNA_019744	hsa-miR-1301-3p	hsa-miR-6812-5p	hsa-miR-650	hsa-miR-4739	hsa-miR-4459
hsa_circRNA_103887	hsa-miR-890	hsa-miR-766-5p	hsa-miR-125a-3p	hsa-miR-10b-3p	hsa-miR-571
hsa_circRNA_101836	hsa-miR-744-5p	hsa-miR-576-3p	hsa-miR-661	hsa-miR-9-5p	hsa-miR-377-5p
hsa_circRNA_406791	hsa-miR-627-3p	hsa-miR-338-3p	hsa-miR-34 c-5p	hsa-miR-4659a-3p	hsa-miR-3688-5p
hsa_circRNA_102995	hsa-miR-424-5p	hsa-miR-16-5p	hsa-miR-195-5p	hsa-miR-15b-5p	hsa-miR-323a-3p
hsa_circRNA_102183	hsa-miR-218-1-3p	hsa-miR-758-3p	hsa-miR-218-5p	hsa-miR-486-5p	hsa-miR-202-3p
hsa_circRNA_000581	hsa-miR-378a-3p	hsa-miR-185-5p	hsa-miR-378d	hsa-miR-422a	hsa-miR-501-5p
hsa_circRNA_101837	hsa-miR-766-5p	hsa-miR-509-5p	hsa-miR-18b-5p	hsa-miR-18a-5p	hsa-miR-380-3p
hsa_circRNA_103572	hsa-miR-29b-2-5p	hsa-miR-544a	hsa-miR-29a-5p	hsa-miR-518 c-5p	hsa-miR-214-3p
hsa_circRNA_101771	hsa-miR-647	hsa-miR-370-3p	hsa-miR-520 c-3p	hsa-miR-526b-3p	hsa-miR-520b
hsa_circRNA_092476	hsa-miR-5007-5p	hsa-miR-760	hsa-miR-4722-5p	hsa-miR-545-3p	hsa-miR-4527

Table 3. Comparison of candidate circRNAs expression in microarray and PCR

CircRNAs	Microarray			PCR
	FC (abs)	P-value	Regulation	FC (abs)	P-value	Regulation
hsa_circRNA_000581	16.2844189	0.001973896	down	2.287937	0.0238	down
hsa_circRNA_092476	14.8670307	0.003552554	down	3.079344	0.0004	down
hsa_circRNA_101836	19.8648936	0.021279368	down	2.766612	0.0142	down
hsa_circRNA_102183	16.3927337	0.003117049	down	3.118147	0.0066	down
hsa_circRNA_103372	21.0471532	0.034767906	up	3.46493	0.0468	up

Table 4. Sequences of primers used for qRT-PCR assay

Gene name	Primer sequence	Ta Opt (^◦C)	Product size (bp)
β-actin (H)	F:5ʹ GTGGCCGAGGACTTTGATTG3’	60	73
	R:5ʹCCTGTAACAACGCATCTCATATT3’
hsa_circRNA_092476	F:5ʹ AGCAACAGACTCTCCTGCAGA3’	60	135
	R:5ʹ ACTTGCTGCTTGTGTATCCAG 3’
hsa_circRNA_101836	F:5ʹ CCCATTATGAAACTGAAGGTAGC3’	60	126
	R:5ʹGATGGAGGTGGATCTACATTAAAGA3’
hsa_circRNA_102183	F:5ʹ TCAAATTCAGGCGTTGTTCAA 3’	60	181
	R:5ʹ TCTGCTGCTCCAGTCGTTTT 3’
hsa_circRNA_103372	F:5ʹ GTGTGTGTGGCATGCAGC 3’	60	104
	R:5ʹ TGGGAACTTATATTCCCCTTC 3’
hsa_circRNA_000581	F:5ʹ GCAGGCCAAGTCCAGCTTATA 3’	60	82
	R:5ʹ ACCAACCTCATGGGATTGTTTC 3’

Figure 3. qRT-PCR validation of five selected circRNAs. (a) Relative expression levels of has_circRNA_103372. (b) Relative expression levels of has_circRNA_000581. (c) Relative expression levels of has_circRNA_102183. (d) Relative expression levels of has_circRNA_101836. (e) Relative expression levels of has_circRNA_092476. Compared with the control, rno_circRNA_000581/102,183/101,838/092476 were significantly downregulated. However, rno_circRNA_103372 was significantly upregulated. The data are normalized using the mean ± SEM (*P < 0.05; n = 6 per group)

Figure 4. The circRNA/miRNA/mRNA network analysis. The network includes 5 brown nodes circRNAs, 13 red nodes miRNAs and 655 blue nodes mRNAs

Figure 5. The GO annotations for biological process of target mRNAs regulated by the five candidate circRNAs. Pie (a), bar (b) point charts (c), and dot plot (d) showed the top 10 counts of significant enrichment items

Figure 6. The GO annotations for cellular component of target mRNAs regulated by the five candidate circRNAs. Pie (a), bar (b) point charts (c), and dot plot (d) showed the top 10 counts of significant enrichment items

Figure 7. The GO annotations for molecular function of target mRNAs regulated by the five candidate circRNAs. Pie (a), bar (b) point charts (c), and dot plot (d) showing the top 10 counts of significant enrichment items

Figure 8. KEGG pathway analysis of five target genes regulated by circRNAs. the bar plot (a), dot plot (b) and related pathway (c) showed the top 10 enrichment score values of the significantly enriched pathway

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article. https://pan.baidu.com/s/1RbY4bcv8Bu2jiy2YKKp1HA