microRNA-211-5p predicts the progression of postmenopausal osteoporosis and attenuates osteogenesis by targeting dual specific phosphatase 6

Figures & data

Table 1. The primer sequence of each gene

Gene Primer sequence (5ʹ→3ʹ)
miR-211-5p F: ACACTCCAGCTGGGCAAGTAGCATCAACTA R: TGGTGTCGTGGAGTCG
DUSP6 F: GAACTGTGGTGTCTTGGTACATT R: GTTCATCGACAGATTGAGCTTCT
GAPDH F: CTCCTCCTGTTCGACAGTCAGC R: CCCAATACGACCAAATCCGTT U6 F: CTCGCTTCGGCAGCACA R: AACGCTTCACGAATTTGCGT

Figure 1. miR-211-5p was knocked down in the plasma of PMOP patients and positively correlated with plasma Vit-D and BMD levels.

The plasma samples were harvested from 20 healthy controls and 75 PMOP patients. (a) qRT-PCR checked miR-211-5p’s expression in the plasma. (b) ELISA determined 25-OH-D concentration in the plasma. (c) Lumbar BMD. (d) The correlation between miR-211-5p and 25-OH-D. (e) The association between miR-211-5p and lumbar BMD. ***P < 0.001 (vs. the Normal group).

Figure 2. miR-211-5p overexpression enhanced hMSC osteogenic differentiation.

A miR-211-5p overexpression model was engineered in hMSCs. (a) qRT-PCR confirmed miR-211-5p expression following cell transfection. (b) ALP activity was gauged employing the ALP assay kit. (c-e) WB evaluated the profiles of TRAP, NFAT2, c-FOS, Runx2, OCN, and CTSK. (f-g) Alizarin red staining monitored osteogenic differentiation, while oil red O staining tracked adipogenesis. *P < 0.05, **P < 0.01 (vs. the miR-NC group). N = 3.

Figure 3. miR-211-5p knockdown hampered hMSC osteogenic differentiation.

A miR-211-5p knockdown model was set up in hMSCs. (a) RT-PCR ascertained miR-211-5p profile. (b) The ALP kit was taken to check ALP activity. (c-e) The profiles of TRAP, NFAT2, c-FOS, Runx2, OCN, and CTSK. (f-g) Alizarin red staining examined osteogenic differentiation, whereas oil red O staining checked adipogenesis. *P < 0.05, **P < 0.01 (vs. the miR-NC group). N = 3.

Figure 4. DUSP6 was targeted by miR-211-5p.

(a)The base complementary sequences of DUSP6 and miR-211-5p. (b) Dual-luciferase reporter assay assessed the binding correlation between miR-211-5p and DUSP6. nsP >0.05, **P < 0.01 (vs. the miR-NC group). (c) RIP analysis verified the association between miR-211-5p and DUSP6. **P < 0.01 (vs. the IgG group). (d) qRT-PCR determined the profile of DUSP6 following miR-211-5p overexpression. ** P < 0.01 (vs. the miR-NC group). (e) qRT-PCR revealed DUSP6 expression after miR-211-5p was knocked down. **P < 0.01 (vs. the miR-in group). N = 3.

Figure 5. DUSP6 overexpression dampened the osteogenic differentiation of hMSCs.

A DUSP6 overexpression model was engineered. (a) The profile of DUSP6. (b) The activity of ALP. (c) The profiles of TRAP, NFAT2, c-FOS, Runx2, OCN, and CTSK. (d-e) Alizarin red staining examined osteogenic differentiation, whereas oil red O staining checked adipogenesis. *P < 0.05, **P < 0.01 (vs. the pcDNA-vector group). N = 3.

Figure 6. miR-211-5p overexpression abated the DUSP6-mediated inhibition of hMSC osteogenic differentiation.

On the basis of pcDNA-DUSP6 transfection, hMSCs were transfected along with miR-211-5p mimics. (a) DUSP6 expression was lowered. (b) ALP activity. (c) The profiles of TRAP, NFAT2, c-FOS, Runx2, OCN, and CTSK. (d-e) Alizarin red staining examined osteogenic differentiation, whereas oil red O staining tracked adipogenesis. *P < 0.05, **P < 0.01 (vs. the pcDNA-DUSP6 group). N = 3.

Figure 7. Regulation of the ERK-Smad/β-catenin pathway by miR-211-5p and DUSP6.

(a) WB verified ERK-Smad/β-catenin pathway expression after miR-211-5p overexpression. *P < 0.05 (vs. the miR-NC group). (b) The profile of the ERK-Smad/β-catenin pathway following miR-211-5p knockdown. *P < 0.05, **P < 0.01 (vs. the miR-in group). (c-d) miR-211-5p was overexpressed on the basis of DUSP6, and the profile of the ERK-Smad/β-catenin pathway was ascertained. **P < 0.01 (vs. the pcDNA-vector group). *P < 0.05, **P < 0.01 (vs. the pcDNA-DUSP6 group). N = 3.

Figure 8. ERK pathway activation impeded the DUSP6-mediated inhibition of hMSC osteogenic differentiation.

Following pcDNA-DUSP6 transfection, hMSCs were dealt with the ERK Agonist PAR-C16 (4 μM). (a) The profiles of DUSP6 and the ERK-Smad/β-catenin pathway. (b) ALP activity. (c-d) The profiles of TRAP, NFAT2, c-FOS, Runx2, OCN, and CTSK. (e-f) Alizarin red staining examined osteogenic differentiation, whereas oil red O staining tracked adipogenesis. *P < 0.05, **P < 0.01 (vs. the pcDNA-DUSP6 group). N = 3.

Figure 9. Schematic diagram of miR-211-5p in hMSC osteogenic differentiation.

miR-211-5p targets DUSP6 and inhibits its expression. DUSP6 inactivates the ERK-Smad/β-catenin pathway. MiR-211-5p overexpression promotes ERK-Smad/β-catenin pathway by targeting DUSP6, thus enhancing the osteogenic differentiation of hMSC.

Data Availability Statement

The data sets used and analyzed during the current study are available from the corresponding author on reasonable request.