Circular RNA circ_UBAP2 facilitates the progression of osteosarcoma by regulating microRNA miR-637/high-mobility group box (HMGB) 2 axis

Figures & data

Table 1. Sequences used for qRT-PCR

Gene		Sequence (5`to3`)
circUBAP2 primer miR-637 primer HMGB2 primer U6 primer GAPDH primer	F R F R F R F R F R	CCAGTTCTTAGCCAGTTGA TGTCTCCAGGTGTTGATTC AGCCCACACACTACAGGCA GCACAAAAGCAGTACGACCT TATGGCAAAAGCGGACAAGG CTTCGCAACATCACCAATGGA CTCGCTTCGGCAGCACATATACT ACGCTTCACGAATTTGCGTGTC CTCCATCCTGGCCTCGCTGT GCTGTCACCTTCACCGTTCC

Table 2. Correlations of circUBAP2 with clinical characteristics in osteosarcoma patients

Clinical parameters	Cases	circUBAP2 expression		P value
		Low (n = 20)	High (n = 20)
Gender				0.751
Male	22	10	12
Female	18	10	8
Age (years)				0.748
<18	24	13	11
≥18	16	7	9
Location				0.343
Femur 20 12 8
Other 20 8 12
Tumor size (cm)				0.461
<8	22	15	7
≥8	18	5	13
TNM stage				0.048*
I–II	15	11	4
III	25	9	16
Distant metastasis				0.010*
No	19	14	5
Yes	21	6	15

*P < 0.05.

Figure 1. Circ_UBAP2 is highly expressed in OS.a). circ_UBAP2 levels within OS and non-carcinoma tissues (n = 40) were measured by qRT-PCR. b). circ_UBAP2 levels within OS cells (U-2OS, MG63, SaOS-2, HOS) and healthy osteoblasts (hFOB1.19) were detected by qRT-PCR. c). RNase treated in HOS cells, circ_UBAP2 and GAPDH expression was measured to confirm the higher stability of circ_UBAP2 than the linear RNA. d). RNase treated in SaOS-2 cells, circ_UBAP2 and GAPDH expression was measured to confirm the higher stability of circ_UBAP2 than the linear RNA. *P < 0.05, ** P < 0.01.

Figure 2. Roles of circ_UBAP2 on proliferation, migration, invasion and apoptosis of OS cells.a) circ_UBAP2 level was measured following the transfection of pc-circ_UBAP2 (or pc-control) into HOS cells through qRT-PCR. b) circ_UBAP2 levels were measured following the transfection of circ_UBAP2 siRNA (or siRNA NC) in SaOS-2 cells via qRT-PCR. c) Transfected HOS cell proliferation was measured through CCK-8 assay. d) Transfected SaOS-2 cell proliferation was measured through CCK-8 assay. e) Invasion and migration of transfected HOS cells analyzed by Transwell assay. f) Invasion and migration of SaOS-2 cells after the transfection analyzed by Transwell assay. g) Transfected HOS cell apoptosis measured through flow cytometry. h) Transfected SaOS-2 cell apoptosis detected through flow cytometry. * P < 0.05, ** P < 0.01.

Figure 3. MiR-637 is the circ_UBAP2 target.a) qRT-PCR detected subcellular localization of circ_UBAP2 in HOS cells. b) qRT-PCR detected subcellular localization of circ_UBAP2 in SaOS-2 cells. c) Binding sequences of miR-637 with circ_UBAP2 predicted with bioinformatics. d) Targeting relation of miR-637 with circ_UBAP2 was measured through dual-luciferase reporter assay within HOS cells. e) Targeting relation of miR-637 with circ_UBAP2 was measured through dual-luciferase reporter assay within SaOS-2 cells. f) qRT-PCR detected expression of streptavidin-captured circ_UBAP2 after biotin-labeled miR-637 (bio-wt-miR-637), bio-mut-miR-637 or negative control (bio-NC) were transfected into OS cells. g) miR-637 levels within OS cells were detected through qRT-PCR upon circ_UBAP2 over-expression within HOS cells or silencing within SaOS-2 cells. * P < 0.05, ** P < 0.01.

Figure 4. MiR-637 functions a tumor suppressive effect on OS.a) miR-637 levels were measured within OS and corresponding non-carcinoma tissues (n = 40) by qRT-PCR. b) miR-637 level showed negative correlation with circ_UBAP2 levels within OS tissues. c) miR-637 levels within OS cells (U-2OS, MG63, SaOS-2, HOS) and healthy osteoblasts (hFOB1.19) were measured by qRT-PCR. D) miR-637 levels were measured upon co-transfection of miR-637 inhibitor (or inhibitor NC) with miR-637 mimic (or mimic NC) in OS cells through qRT-PCR. e) Ttransfected HOS cell proliferation was detected through CCK-8 assay. f) Transfected SaOS-2 cell proliferation was detected through CCK-8 assay. g) Invasion and migration of transfected HOS and SaOS-2 cells were analyzed through Transwell assays. h) Transfected HOS and SaOS-2 cell apoptosis was analyzed through flow cytometry. *P < 0.05, ** P < 0.01.

Figure 5. MiR-637 partially reverses the tumor-promoting effect of circ_UBAP2 on OS cells.HOS cells with stable over-expression of circ_UBAP2 were transfected with miR-637 mimic, while SaOS-2 cells with circ_UBAP2 silencing were subjected to miR-637 inhibitor transfection. a) miR-637 expression within OS cells was analyzed through qRT-PCR. b) Transfected HOS and SaOS-2 cell proliferation was detected through CCK-8 assay. c) Invasion and migration of transfected HOS and SaOS-2 cells were analyzed through Transwell assays. d) Transfected HOS and SaOS-2 cell apoptosis was analyzed through flow cytometry. *P < 0.05, **P < 0.01.

Figure 6. HMGB2 is the target of miR-637.a) Bioinformatics analysis conducted for predicting binding relation of miR-637 with HMGB2. b) The targeting relation of miR-637 with HMGB2 within OS cells was confirmed through dual-luciferase reporter assay. c) HMGB2 levels within OS cells following miR-637 mimic transfection in HOS cells or miR-637 inhibitor transfection into SaOS-2 cells were analyzed through qRT-PCR. d) HMGB2 expression within OS cells following miR-637 mimic transfection in HOS cells or miR-637 inhibitor transfection into SaOS-2 cells was analyzed through WB assay. *P < 0.05, **P < 0.01.

Figure 7. Circ_UBAP2 promotes OS progression by regulating HMGB2.HOS cells with stable over-expression of circ_UBAP2 and SaOS-2 cells with circ_UBAP2 silencing were subjected to pc-HMGB2 transfection, respectively. a) HMGB2 levels within OS cells were analyzed through qRT-PCR. b) Transfected HOS and SaOS-2 cell proliferation was evaluated through CCK-8 assay. c) Transfected HOS and SaOS-2 cell invasion and migration were measured through Transwell assays. d) Transfected HOS and SaOS-2 cell apoptosis was analyzed through flow cytometry. * P < 0.05, **P < 0.01

Figure 8. Circ_UBAP2 promotes OS tumor growth in vivo by regulating miR-637/HMGB2 axis.HOS cells stably transfected with sh-circ_UBAP2 or sh-con were subcutaneously injected into mice. a) Tumor volume was calculated. b) Representative pictures of tumor were presented. c) Tumor weight was calculated on the day mice were sacrificed. d) qRT-PCR was to detect the expression of circ_UBAP2. e) qRT-PCR was to detect the expression of miR-637. F) qRT-PCR was to detect the expression of HMGB2.

Data availability statement

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.