Circular RNA coiled-coil domain containing 66 regulates malignant development of papillary thyroid carcinoma by upregulating La ribonucleoprotein 1 via the sponge effect on miR-129-5p

Figures & data

Table 1. Sequences of primers for qRT-PCR

Name		Sequence
Circ-CCDC66	Forward	5’- TCTCTTGGACCCAGCTCAG −3’
	Reverse	5’- TGAATCAAAGTGCATTGCCC −3’
miR-129-5p	Forward	5’- CGGCGGTTTTTTGCGGTCTGGGCT −3’
	Reverse	5’- AGCCCAGACCGCAAAAAACCGCCG −3’
LARP1	Forward	5’ – GCAACCTAAAGACACTAC-3’
	Reverse	5’-GTGCAGGGTCCGAGGT-3’
GAPDH	Forward	5’-GCACCGTCAAGGCTGAGAAC-3’
	Reverse	5’-GGATCTCGCTCCTGGAAGATG-3’
U6	Forward	5’- GCTTCGGCAGCACATATACTAAAAT-3’
	Reverse	5’- CGCTTCACGAATTTGCGTGTCAT −3’

Table 2. Relationship between circ-CCDC66 expression and the clinical pathological characteristics of PTC patients (n = 60)

Clinic pathological features		NO. of cases	Circ-CCDC66 (n, %)		p – value
			Low	High
Gender	Male	32	15	17	P > 0.05
	Female	28	13	15
Age	≤ 55	40	18	22	P > 0.05
	> 55	20	8	12
Extra thyroidal extension	Negative	19	8	11	P > 0.05
	Positive	41	16	25
Tumor size	≤1	42	28	14	P = 0.0099
	>1	18	5	13
TNM stage	I/II	34	22	12	P = 0.0362
	III/IV	26	9	17
Lymph node metastasis	Negative	27	19	8	P = 0.0089
	Positive	33	11	22
Nodular Goiter	Negative	38	18	20	P > 0.05
	Positive	22	10	12

Figure 1. Circ-CCDC66 is upregulated in PTC and correlated to poor prognosis.

A. Relative levels of circ-CCDC66 in PTC specimens (n = 60) and paracancerous ones (n = 60) detected by qRT-PCR; B. Correlation between circ-CCDC66 level and AJCC staging of PTC; C. Correlation between circ-CCDC66 level and lymphatic metastasis of PTC; D. Kaplan–Meier curves depicted survival of PTC patients with high or low level of circ-CCDC66 (p = 0.0058); E. Relative levels of circ-CCDC66 in PTC cell lines detected by qRT-PCR; F. Relative levels of circ-CCDC66 and linear CCDC66 mRNA in K1 and TPC-1 cells exposed to Actinomycin D detected by qRT-PCR; G. Stability of circ-CCDC66 and linear CCDC66 mRNA in K1 and TPC-1 cells induced with RNase R. *p < 0.05; **p < 0.01.

Figure 2. Knockdown of circ-CCDC66 suppressed proliferative, migratory and invasive capacities of PTC.

A. Transfection efficacy of circ-CCDC66 siRNAs in K1 and TPC-1 cells examined by qRT-PCR; B-C. Proliferative capacity of K1 and TPC-1 cells transfected with si-circ-CCDC66 or si-NC examined by CCK-8 and EdU assay; D-E. Migratory and invasive capacities of K1 and TPC-1 cells transfected with si-circ-CCDC66 or si-NC examined by Transwell assay. *p < 0.05; **p < 0.01.

Table 3. Relationship between miR-129-3p expression and the clinical pathological characteristics of PTC patients (n = 60)

Clinic pathological features		NO. of cases	miR-129-3p (n, %)		p – value
			Low	High
Gender	Male	32	16	16	P > 0.05
	Female	28	15	13
Age	≤ 55	40	17	23	P > 0.05
	> 55	20	11	9
Extra thyroidal extension	Negative	19	6	13	P > 0.05
	Positive	41	24	17
Tumor size	≤1	42	15	27	P = 0.0463
	>1	18	12	6
TNM stage	I/II	34	11	23	P = 0.0086
	III/IV	26	18	8
Lymph node metastasis	Negative	27	10	17	P = 0.0185
	Positive	33	23	10
Nodular Goiter	Negative	38	22	16	P > 0.05
	Positive	22	11	11

Figure 3. Circ-CCDC66 could bind miR-129-5p.

A. Subcellular distribution of circ-CCDC66 in K1 and TPC-1 cells; B. Potential miRNAs that could bind circ-CCDC66 as predicted using starBase (http://starbase.sysu.edu.cn/); C. Construction of wild-type and mutant-type circ-CCDC66 vectors based on the predicted binding sites of circ-CCDC66 and miR-129-5p in starBase (http://starbase.sysu.edu.cn/); D. Dual-luciferase reporter assay showed luciferase activity in wild-type and mutant-type circ-CCDC66 vectors transfected with either miR-129-5p mimics or NC; E. RIP showed the interaction between circ-CCDC66 and miR-129-5p; F. Relative levels of miR-129-5p in K1 and TPC-1 cells with overexpression or knockdown of circ-CCDC66; G. Relative levels of miR-129-5p in PTC and paracancerous specimens; H. Pearson’s correlation test obtained a negative correlation between circ-CCDC66 and miR-129-5p in PTC specimens (R² = −0.41, p < 0.001). *p < 0.05; **p < 0.01.

Table 4. Relationship between LARP1 expression and the clinical pathological characteristics of PTC patients (n = 60)

Clinic pathological features		NO. of cases	LARP1 (n, %)		p – value
			Low	High
Gender	Male	32	14	18	P > 0.05
	Female	28	12	16
Age	≤ 55	40	16	24	P > 0.05
	> 55	20	9	11
Extra thyroidal extension	Negative	19	10	9	P > 0.05
	Positive	41	18	23
Tumor size	≤1	42	25	17	P = 0.0112
	>1	18	4	14
TNM stage	I/II	34	20	14	P = 0.0392
	III/IV	26	8	18
Lymph node metastasis	Negative	27	20	7	P = 0.0046
	Positive	33	12	21
Nodular Goiter	Negative	38	20	18	P > 0.05
	Positive	22	9	13

Figure 4. miR-129-5p could bind LARP1.

A. Potential targets of miR-129-5p predicted in microT, PITA, miRmap, microT, miRanda and Targetscan, and LARP1 was screened out after cross-match; B. Construction of wild-type and mutant-type LARP1 vectors based on the predicted binding sites of LARP1 and miR-129-5p in starBase (http://starbase.sysu.edu.cn/); C. Dual-luciferase reporter assay showed luciferase activity in wild-type and mutant-type LARP1 vectors transfected with either miR-129-5p mimics or NC; D-E. The mRNA and protein levels of LARP1 in K1 and TPC-1 cells with overexpression or knockdown of miR-129-5p; F. Relative levels of LARP1 in PTC and paracancerous specimens; G. Pearson’s correlation test obtained a negative correlation between LARP1 and miR-129-5p in PTC specimens (R² = 0.39, p < 0.001); H. Pearson’s correlation test obtained a positive correlation between LARP1 and circ-CCDC66 in PTC specimens (R² = 0.62, p < 0.001). *p < 0.05; **p < 0.01.

Figure 5. Circ-CCDC66 was involved in the development of PTC through the miR-129-5p/LARP1 axis.

A. Relative level of LARP1 in K1 and TPC-1 cells co-transfected with LARP1-siRNA or miR-129-5p inhibitor and circ-CCDC66-OE; B. Protein level of LARP1 in K1 and TPC-1 cells co-transfected with LARP1-siRNA or miR-129-5p inhibitor and circ-CCDC66-OE; C. Proliferative capacity of K1 and TPC-1 cells co-transfected with LARP1-siRNA or miR-129-5p inhibitor and circ-CCDC66-OE examined by EdU assay; D-E. Migratory and invasive capacities of K1 and TPC-1 cells co-transfected with LARP1-siRNA or miR-129-5p inhibitor and circ-CCDC66-OE. *p < 0.05; **p < 0.01; #p < 0.05.

Figure 6. Inhibition of circ-CCDC66 could suppress PTC tumor growth.

A. Nude mouse models were established via subcutaneous injection of TPC-1 cells and divided into LV-sh-NC group and LV-sh-circ-CCDC66 group; B-C. Effects of sh-circ-CCDC66 on tumor volume and tumor weight. **p < 0.01.

Data availability statement

All data included in this study are available upon request by contacting the corresponding author.