6-Methoxyflavone induces S-phase arrest through the CCNA2/CDK2/p21CIP1 signaling pathway in HeLa cells

Figures & data

Table 1. Primer sequences used for the quantitative polymerase chain reaction

Primer (human)	Forward	Reverse
CCNA2	CGCTGGCGGTACTGAAGTC	GAGGAACGGTGACATGCTCAT
CCNB1	AATAAGGCGAAGATCAACATGGC	TTTGTTACCAATGTCCCCAAGAG
CCND1	GCTGCGAAGTGGAAACCATC	CCTCCTTCTGCACACATTTGAA
CCNE1	AAGGAGCGGGACACCATGA	ACGGTCACGTTTGCCTTCC
CDK1	AAACTACAGGTCAAGTGGTAGCC	TCCTGCATAAGCACATCCTGA
CDK2	CCAGGAGTTACTTCTATGCCTGA	TTCATCCAGGGGAGGTACAAC
CDK4	ATGGCTACCTCTCGATATGAGC	CATTGGGGACTCTCACACTCT
CDK6	GCTGACCAGCAGTACGAATG	GCACACATCAAACAACCTGACC
P16INK4A	GATCCAGGTGGGTAGAAGGTC	CCCCTGCAAACTTCGTCCT
p21CIP1	TGTCCGTCAGAACCCATGC	AAAGTCGAAGTTCCATCGCTC
TP53	CAGCACATGACGGAGGTTGT	TCATCCAAATACTCCACACGC
RB	CTCTCGTCAGGCTTGAGTTTG	GACATCTCATCTAGGTCAACTGC

Abbreviations: CCNA2: cyclin A2; CCNB1: cyclin B1; CCND1: cyclin D1; CCNE1: cyclin E1; CDK1: cyclin-dependent kinase 1; CDK2: cyclin-dependent kinase 2; CDK4: cyclin-dependent kinase 4; CDK6: cyclin dependent kinase 6; P16INK4: cyclin dependent kinase inhibitor 2A; p21CIP1: cyclin-dependent kinase inhibitor 1A; TP53: tumor protein p53; RB: retinoblastoma transcriptional corepressor 1.

Figure 1. Functional enrichment analyses of 178 targets. A. The 10 most common KEGG pathways (p < 0.0001). B. KEGG pathways related to cancer. C. Biological processes related to cell proliferation. D and F. Functional enrichment terms related to cell cycles and drugs (p < 0.05). E. Genes enriched in six cell cycle items. G. Principal component analysis of the genes enriched in the cell cycle. H. Intersections of the 178 targets and the DEmRNAs of cervical cancer. I. Intersections among the targets of the principal component analysis and DEmRNAs. Abbreviations: KEGG: Kyoto Encyclopedia of Genes and Genomes; DEmRNAs: differentially expressed mRNAs; FoxO: forkhead box O; PPAR: peroxisome proliferator activated receptor; CCNA2: cyclin A2; DHFR: dihydrofolate reductase; CHEK1: checkpoint kinase 1; EGFR: epidermal growth factor receptor; ADAM17: ADAM metallopeptidase domain 17; CDK2: cyclin-dependent kinase 2; CDK6: cyclin dependent kinase 6; CDK7: cyclin-dependent kinase 7; GSK3B: glycogen synthase kinase 3 beta; TGFB2: transforming growth factor beta 2; EIF4E: eukaryotic translation initiation factor 4E; PIM1: Pim-1 proto-oncogene, serine/threonine kinase; FGFR1: fibroblast growth factor receptor 1; FGFR2: fibroblast growth factor receptor 2.

Figure 2. Gene set enrichment analyses of CCNA2 and CDK2. A. The five most common KEGG pathways or biological processes of each dataset (q < 0.01). B. The highest normalized enrichment score terms of each dataset. Abbreviations: KEGG: Kyoto Encyclopedia of Genes and Genomes; P53: tumor protein p53; CCNA2: cyclin A2; CDK2: cyclin-dependent kinase 2.

Figure 3. Eukaryotic transcriptome sequencing results of HeLa cells after 6-methoxyflavonoid treatment. Three control samples were treated with 0.16% dimethyl sulfoxide. Three treatment samples were treated with 65 μM 6-methoxyflavone. A. Minus versus add plot of differential expressed transcripts. B. The 10 most common KEGG pathways of differential expressed transcripts (p < 0.05). C and D. Gene oncology enrichment results of differential expressed transcripts. Cell cycle-related or proliferation-related biological processes (p < 0.05). Abbreviations: TPM: transcripts per million; HTLV-I: human T-lymphotropic virus type I; PI3K: phosphoinositide 3-kinase; Akt: protein kinase B.

Figure 4. 6-Methoxyflavone inhibits cervical cancer cell proliferation and induces S-phase arrest in HeLa cells. A. Inhibition ratios of HaCaT, HeLa, C33A, and SiHa cells. The four cells were treated with six concentrations of 6-methoxyflavone (0.16% DMSO, 20 μM, 40 μM, 80 μM, 120 μM, and 160 μM) for 48 hours. Six replicate holes were used at each concentration level. A water-soluble tetrazolium salt-8 kit was used to measure the inhibitory effects. B. Inhibition ratio of HeLa cell proliferation. HeLa cells were treated with six concentrations of 6-methoxyflavone for 24 hours, 48 hours, and 72 hours. C. After propidium iodide staining, the distribution of HeLa cell cycle phases was measured using flow cytometry. D. The histogram shows the ratio of the HeLa cell cycle phases in Figure 3c. All experiments were performed using three biological replicates. Statistical analysis was performed using a one-way analysis of variance (ANOVA). *p < 0.05. **p < 0.01. n.s.: not significant. DMSO: dimethyl sulfoxide.

Table 2. Core mRNA biomarker expression levels of transcriptome sequencing

GeneName	GeneID	Transcript id	log2FoldChange	qValue
CCNA2	ENSG00000145386	ENST00000618014	−0.8277	0.0003
CCND1	ENSG00000110092	ENST00000227507	0.8394	2.66E-11
CCNE1	ENSG00000105173	ENST00000357943	0.6317	0.8789
CDK2	ENSG00000123374	ENST00000554619	−1.3566	0.0358
CDK6	ENSG00000105810	ENST00000265734	1.0095	0.0247
p21CIP1	ENSG00000124762	ENST00000615513	1.2123	0.0058

Abbreviations: CCNA2: cyclin A2; CCND1: cyclin D1; CCNE1: cyclin E1; CDK2: cyclin-dependent kinase 2; CDK6: cyclin dependent kinase 6; p21CIP1: cyclin-dependent kinase inhibitor 1A.

Figure 5. 6-Methoxyflavone induces S-phase arrest through the CCNA2/CDK2/p21CIP1 pathway. HeLa cells were treated with 6-methoxyflavone (0.16% DMSO and 65 μM) for 48 hours. Cell cycle-related mRNA and protein expression were measured by PCR and western blotting. A. The relative mRNA expressions of CCNA2, CCNB1, CCND1, CCNE1, CDK1, CDK2, CDK4, CDK6, P16INK4, p21CIP1, TP53, and RB. B and C. Protein expressions of CCNA2, CCND1, CCNE1, CDK2, CDK6, and p21CIP1. Each assay was performed in triplicate. Statistical analysis was performed using the paired t-test. *p < 0.05. **p < 0.01. n.s.: not significant. Abbreviations: CCNA2: cyclin A2; CCNB1: cyclin B1; CCND1: cyclin D1; CCNE1: cyclin E1; CDK1: cyclin-dependent kinase 1; CDK2: cyclin-dependent kinase 2; CDK4: cyclin-dependent kinase 4; CDK6: cyclin dependent kinase 6; P16INK4: cyclin dependent kinase inhibitor 2A; p21CIP1: cyclin-dependent kinase inhibitor 1A; TP53: tumor protein p53; RB: retinoblastoma transcriptional corepressor 1.

Table 3. Molecular docking parameters of 6-methoxyflavone and receptors

Targets	Ligand	Interactions	Minimum binding affinity (kcal/M)	Ki/Kd values (μM)	Distance/Bond length (Å)
CCNA2	6MF	Hydrophobic Interactions	−7.1	6.16	2.49
CDK2	6MF	Hydrophobic Interactions	−8.6	0.49	2.30
CDK2	6MF	Hydrogen Bonds	−8.6	0.49	2.73
CCNA2_CDK2	6MF	Hydrogen Bonds	−8.8	0.35	3.625
CCNA2_CDK2	6MF	Salt Bridge	−8.8	0.35	4.20

Abbreviations: Ki: inhibition constant; Kd: dissociation constant; 6MF: 6-Methoxyflavone

Figure 6. Affinity and noncovalent interactions between 6-methoxyflavone and receptors. A and C. The results of molecular dockings between 6-methoxyflavone and CCNA2, CDK2, p21CIP1, and the CCNA2–CDK2 complex. B and D. The noncovalent interactions between 6-methoxyflavone and CCNA2, CDK2, and CCNA2–CDK2 complex. E. The noncovalent interactions between 6-methoxyflavone and CCNA2, CDK2, and the CCNA2–CDK2 complex. Abbreviations: CCNA2: cyclin A2; CDK2: cyclin-dependent kinase 2; p21CIP1: cyclin-dependent kinase inhibitor 1A.

Table 4. Relationships between mRNA expression levels of six targets and the clinicopathological parameters of cervical cancer patients

Parameters	Relative expression of CCNA2			Relative expression of CCND1			Relative expression of CCNE1			Relative expression of CDK2			Relative expression of CDK6			Relative expression of p21CIP1
	High	Low	P	High	Low	P	High	Low	P	High	Low	P	High	Low	P	High	Low	P
Age (n = 304)
≥60 years old	34	31	0.67	33	32	0.89	31	34	0.67	25	40	0.04*	27	38	0.12	33	32	0.89
<60 years old	118	121		119	120		121	118		127	112		125	114		119	120
Histological classification (n = 304)
Squamous cell cancer	130	122	0.22	133	119	0.03*	133	119	0.03*	137	115	<0.01**	146	106	<0.01**	144	108	<0.01**
Adenocarcinoma	22	30		19	33		19	33		15	37		6	46		8	44
Primary tumor (n = 241)
T1-T2	102	109	0.86	96	115	0.14	104	107	0.45	104	107	0.94	96	115	0.03*	104	107	0.15
T3-T4	15	15		18	12		17	13		15	15		20	10		19	11
Lymph node invasion (n = 193)
N0	64	69	0.65	61	72	0.59	63	70	0.93	67	66	0.36	61	72	0.34	65	68	0.32
N1	31	29		30	30		28	32		26	34		32	28		34	26
FIGO stage (n = 297)
Stage I–II	112	119	0.28	113	118	0.71	113	118	0.56	120	111	0.35	113	118	0.31	106	125	0.02*
Stage III–IV	37	29		34	32		35	31		30	36		37	29		41	25

Statistical analyses were performed using the chi-square test. *p < 0.05, **p < 0.01. Abbreviations: FIGO: Federation International of Gynecology and Obstetrics

Figure 7. Clinical characteristics analyses of six receptors. A. Drug sensitivity data of CCNA2, CCND1, CCNE1, CDK2, CDK2, and p21CIP1. Numbers of drugs related to the six receptors (p < 0.05). B. Drugs related to the six receptors (p < 0.05). Drugs significantly related to the expressions of CCNA2, CCND1, CDK2, and CDK6 (p < 0.05 and |Pearson and Spearman correlation coefficient|≥0.4). C. Overall survival analysis of cervical cancer patients in CCND1 high-expression and low-expression groups (p < 0.05). D. Overall survival analysis of cervical adenocarcinoma patients in p21CIP1 high-expression and low-expression groups(p < 0.05). E and F. Disease free survival analyses of cervical cancer patients in CCNA2 and CDK2 different expression groups.

Abbreviations: CCNA2: cyclin A2; CCND1: cyclin D1; CCNE1: cyclin E1; CDK2: cyclin-dependent kinase 2; CDK6: cyclin-dependent kinase 6; p21CIP1: cyclin-dependent kinase inhibitor 1A.