The effect of insulin and kruppel like factor 10 on osteoblasts in the dental implant osseointegration in diabetes mellitus patients

Figures & data

Table 1. The gene primers of the qRT-PCR analyses.

Genes	Upstream primer sequence	Downstream primer sequence
GAPDH	AGGGGCCATCCACAGTCTTC	AGGGGCCATCCACAGTCTTC
KLF10	CGCTGTCCATTGCAGCTTAC	TGCATGATGCCTTCGTGTTG
ON	CAAGAAGCCCTGCCTGATGA	TCTTCGGTTTCCTCTGCACC
OPG	CCTCTGTGAAAACAGCGTGC	AGGTGTCTTGGTCGCCATTT
RANKL	CACAGCACATCAGAGCAGAG	TACCAAGAGGACAGACTCACTT

Figure 1. Efficiency detection of KLF10 interference (a) and over expression (b) in osteoblasts by quantitative real‐time polymerase chain reaction.

*p < 0.05; **p < 0.01. A total of three biological and technical replicates were performed. The T-test was used for statistical analysis.

Figure 2. The effect of insulin on proliferation (a) and differentiation (b) of osteoblasts.

**p < 0.01; ***p < 0.001. A total of three biological and technical replicates were performed. The T-test was used for statistical analysis.

Figure 3. The effect of KLF10 over expression on proliferation (a) and differentiation (b) of osteoblasts.

***p < 0.001. A total of three biological and technical replicates were performed. The T-test was used for statistical analysis.

Figure 4. The effect of KLF10 knockdown and insulin on proliferation (a) and differentiation (b) of osteoblasts.

*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. A total of three biological and technical replicates were performed. The T-test was used for statistical analysis.

Figure 5. The effect of insulin on mRNA expression of KLF10, ON, OPG and RANKL.

*p < 0.05; ****p < 0.0001. A total of three biological and technical replicates were performed. The T-test was used for statistical analysis.

Figure 6. The effect of KLF10 over expression on mRNA expression of ON, OPG and RANKL.

*p < 0.05; **p < 0.01; ****p < 0.0001. A total of three biological and technical replicates were performed. The T-test was used for statistical analysis.

Figure 7. The effect of KLF10 knockdown and insulin on mRNA expression of KLF10, ON, OPG, and RANKL.

*p < 0.05; **p < 0.01; ****p < 0.0001. A total of three biological and technical replicates were performed. The T-test was used for statistical analysis.

Figure 8. The effect of insulin and KLF10 on protein expression of AKT and NF-kB.

*p < 0.05; **p < 0.01. 1, 2, 3, 4, 5, and 6 represents sh-KLF10 group, sh-NC group, sh-KLF10 + insulin treatment group, sh-NC + insulin treatment group, oe-KLF10 group and oe-NC group, respectively. A total of three biological and technical replicates were performed. The T-test was used for statistical analysis.

Figure 9. Expression box plot of KLF10 in patients with periodontitis and type 2 diabetes mellitus with periodontitis.

Data availability statement

All data are available in the article.