MicroRNA-30c-2-3p represses malignant progression of gastric adenocarcinoma cells via targeting ARHGAP11A

Figures & data

Table 1. Primers of qRT-PCR.

Gene	Primer sequence (5’→ 3’)
miR-30c-2-3p	F:TCCTTTTACAGTTGACCTCAGAAAC
	R:GGCGAATATTTTGAAACCCTTTTGG
ARHGAP11A	F:GCCAAGCTCGGAAAAGAACG
	R:GCATCGACAAGAAAGCTTGGAA
U6	F:CTCGCTTCGGCAGCACA
	R:AACGCTTCACGAATTTGCGT
GAPDH	F:GAACGGGAAGCTCACTGG
	R:GCCTGCTTCACCACCTTCT

Figure 1. MiR-30c-2-3p expression is low in GA tissue/cells. a: On the basis of TCGA database, miR-30c-2-3p level in GA tissue and normal tissue. b: MiR-30c-2-3p level in GA cell lines and normal cell line.

Figure 2. MiR-30c-2-3p suppresses GA cell malignant progression, and promotes apoptosis. a: Overexpression efficiency of miR-30c-2-3p in GA cells. b-c: The impacts of over-expressed miR-30c-2-3p on AGS and HGC-27 cell proliferation. d: The apoptosis rate of GA cells transfected with over-expressed miR-30c-2-3p or NC vectors. e: Migration and invasion of GA cells transfected with over-expressed miR-30c-2-3p or NC vectors (magnification: 100×). f: Cell cycle distribution of AGD and HGC-27 cells following transfection of miR-30c-2-3p mimic or NC. * P < 0.05.

Figure 3. MiR-30c-2-3p down-regulates ARHGAP11A level. a: Venn diagram based on the predicted target genes of miR-30c-2-3p. b: Correlation of miR-30c-2-3p and DEmRNAs were analyzed via Pearson correlation analysis. c: ARHGAP11A levels in normal tissue and GA tissue. d: MiR-30c-2-3p expression in GA cell lines. e: Binding sites of miR-30c-2-3p on ARHGAP11A. f: AGS cell luciferase intensity of in different transfection groups. g: The over-expressed miR-30c-2-3p affected mRNA and (h) protein expression of ARHGAP11A. * P < 0.05.

Figure 4. MiR-30c-2-3p represses malignant progression of GA via modulating ARHGAP11A. a: The transfection effects of over-expressed ARHGAP11A. b-c: Impact of the co-transfection of miR-30c-2-3p and ARHGAP11A on AGS cell proliferation. d-e: Motility of GA cells with over-expressed miR-30c-2-3p and ARHGAP11A (magnification: 100×). f: The apoptosis rate of AGS cells with over-expressed miR-30c-2-3p or ARHGAP11A vector. g: Cell cycle distribution of AGD and HGC-27 cells following transfection of over-expressed miR-30c-2-3p and ARHGAP11A. h: EMT-related proteins in AGS cells with over-expressed miR-30c-2-3p or ARHGAP11A. * P < 0.05, # P < 0.05.

Data availability statements

The data used to support the findings of this study are available from the corresponding author upon request.https://portal.gdc.cancer.gov/