Establishment and characterization of a highly metastatic hepatocellular carcinoma cell line

Figures & data

Table 1. Preoperative laboratory examination of the patients.

Tests	Results	Units	Reference Range
D-dimmer	170	μg/L	0–700 μg/L
Serum prostate specific antigen (PSA)	9.325	ng/ml	0.000–4.000 ng/ml
Alpha fetoprotein (AFP)	368.9	ng/ml	0.0–20.0 ng/ml
Protein-II induced by vitamin K absence (PIVKA-II)	2036	mAU/ml	0–40 mAU/ml
Ferritin	536.5	ng/ml	7.0–323.0 ng/ml
International normalized ratio (INR)	1.25		0.85–1.15
Prothrombin time (PT)	14.3	s	10.0–13.5 s
Serum total protein	50.3	g/L	65.0–85.0 g/L
Serum albumin	33.8	g/L	40.0–55.0 g/L
Serum globulin	16.5	g/L	20.0–40.0 g/L
Alanine aminotransaminase (ALT)	914	U/L	9–50 U/L
Aspartate aminotransferase (AST)	1404	U/L	15–40 U/L
Total cholesterol	1.91	mmol/L	3.14–5.86 mmol/L
High-density lipoprotein (HDL)	0.59	mmol/L	0.78–1.81 mmol/L
Low-density lipoprotein (LDL)	0.86	mmol/L	1.31–3.29 mmol/L

Figure 1. The morphology of HCC-ZJ cells (a); immunohistochemistry for CK7 and CK19 (b); the karyotype of HCC-ZJ cells (c); the CK7 and CK19 positive rate of HCC-ZJ and intrahepatic cholangiocarcinoma (ICC) samples (n = 3) (d). * represents P < 0.05 and ** represents P < 0.01.

Table 2. Short tandem repeat (STR) identification of HCC-ZJ.

Microsatellite (chromosome)	HCC-ZJ		Patients’ blood		DNA from FFPE tissue
	Allele1	Allele2	Allele1	Allele2	Allele1	Allele2
D5S818	10	11	10	11	10	11
D13S317	9	11	9	11	9	11
D7S820	9	11	9	11	9	11
D16S539	9	10	9	10	9	10
VWA	17	17	17	17	17	17
TH01	9	9	9	9	9	9
AMEL	X	Y	X	Y	X	Y
TPOX	8	8	8	8	8	8
CSF1PO	12	13	12	13	12	13
D12S391	17	19	17	19	17	19
FGA	19	24	19	24	19	24
D2S1338	17	19	17	19	17	19
D21S11	31	31	30	31	30	31
D18S51	14	22	14	22	14	22
D8S1179	14	14	14	14	14	14
D3S1358	15	15	15	15	15	15
D6S1043	14	19	14	19	14	19
PENTAE	5	12	5	12	5	12
D19S433	13	14	13	14	13	14
PENTAD	9	9	9	9	9	9
D1S1656	13	15	13	15	13	15

Figure 2. Statistics of the whole-exome sequencing. (a) the numbers and mutation types of genes (upper) and sites (lower) from INDELs; (b) the numbers and mutation types of genes (upper) and sites (lower) from SNPs; (c) the numbers of INDEL sites containing the corresponding number of bases; (d) the number of transitions and transversions based on the four kinds of bases.

Figure 3. Circos plot describing the distribution of SNPs, INDELs, copy number variants (CNVs), and structural variations (SVs) in genome.

Table 3. Nonsynonymous single nucleotide variant (SNV) of HCC-ZJ cell by whole-exome sequencing.

Chromosome	Position	Reference nucleotide	Variant nucleotide	Gene	Region annotation	Variant type	Genotype (GT)	Allele depth (AD)	Q value
17	7579472	G	C	TP53	exonic	nonsynonymous SNV	0/1	31,29	720.64
3	41268766	A	C	CTNNB1	exonic	nonsynonymous SNV	0/1	22,21	415.64
1	27056319	C	T	ARID1A	exonic	stopgain	0/1	15,12	297.64
2	178095983	A	T	NFE2L2	exonic	nonsynonymous SNV	0/1	76,60	1490.64
2	178098948	T	G	NFE2L2	exonic	nonsynonymous SNV	0/1	8,9	259.64
2	178098965	T	G	NFE2L2	exonic	nonsynonymous SNV	0/1	7,9	278.64
6	36645696	A	G	CDKN1A	exonic	nonsynonymous SNV	1/1	0,123	3750.06
6	36652339	C	G	CDKN1A	exonic	nonsynonymous SNV	1/1	1,65	2106.06

Table 4. Frameshift insertion/deletion (INDEL) of HCC-ZJ cell by whole-exome sequencing.

Chromosome	Position	Reference nucleotide	Variant nucleotide	Gene	Region annotation	Variant type	Genotype (GT)	Allele depth (AD)	Q value
5	1302113	A	AC	TERT	Intergenic	Frameshift insertion	1/1	0,4	128.1
1	27099687	GC	G	ARID1A	Intronic	Frameshift deletion	0/1	1,2	71.6
1	27105819	CA	C	ARID1A	Exonic	Frameshift deletion	0/1	37,46	1447.6
1	27107263	T	TC	ARID1A	3’ UTR	Frameshift insertion	0/1	4,3	56.6
9	21968446	TCCAGGCGCGCCGACCGCTCAAGCGC TCCAGGTCCACCCGGCGGAGGGCAG AGAAAGCGCGACCGCGCGGCCCGCA GGGTTGCAAGAAGAAAACGAGTGTT ATATAATGAGTCTCAGTGGTTGCTCACAATG	T	CDKN2A	3’ UTR	Frameshift deletion	0/1	1,2	51.6
9	1899810	GTT	G	SMARCA2	Intergenic	Frameshift deletion	1/1	0,1	35.44
9	2058479	GC	G	SMARCA2	Intronic	Frameshift deletion	0/1	4,2	64.6
9	2058481	AG	A	SMARCA2	Intronic	Frameshift deletion	0/1	4,2	64.6
9	2097548	GA	G	SMARCA2	Intronic	Frameshift deletion	1/1	0,8	210
9	2133646	TA	T	SMARCA2	Intronic	Frameshift deletion	1/1	0,1	35.44
9	2149334	A	AT	SMARCA2	Intronic	Frameshift insertion	1/1	0,1	35.44
9	2160736	TGA	T	SMARCA2	Intronic	Frameshift deletion	1/1	0,10	412.02
9	2207472	ATTTT	A	SMARCA2	Intergenic	Frameshift deletion	1/1	0,1	35.44
9	2598723	GAA	G	SMARCA2	Intergenic	Frameshift deletion	1/1	0,2	64.28
7	81359116	CA	C	HGF	Intronic	Frameshift deletion	1/1	0,13	370.02
17	7577678	CT	C	TP53	Intronic	Frameshift deletion	0/1	6,11	212.6
17	7578711	CTTTT	C	TP53	Intronic	Frameshift deletion	1/1	0,1	35.44
17	7579643	CCCCCAGCCCTCCAGGT	C	TP53	Intronic	Frameshift deletion	0/1	5,31	1237.6
22	37622881	TGG	T	RAC2	Intronic	Frameshift deletion	0/1	30,17	607.6
22	37628053	A	AG	RAC2	Intronic	Frameshift insertion	0/1	32,24	652.6
4	74282092	A	AT	ALB	Intronic	Frameshift insertion	1/1	0,4	102.1
1	27099687	GC	G	ARID1A	Intronic	Frameshift deletion	0/1	1,2	71.6
1	27105819	CA	C	ARID1A	Exonic	Frameshift deletion	0/1	37,46	1447.6
1	27107263	T	TC	ARID1A	3’ UTR	Frameshift insertion	0/1	4,3	56.6
12	45879268	AG	A	ARID2	Intergenic	Frameshift deletion	0/1	2,3	84.6
2	148293282	CTTCCTTCCTTTCTTCCTTTCTTTCTTCTTCT	C	ACVR2A	Intergenic	Frameshift deletion	1/1	0,1	35.44
2	148320287	CT	C	ACVR2A	Intergenic	Frameshift deletion	1/1	0,2	49.28
2	148680896	TGGAC	T	ACVR2A	Intronic	Frameshift deletion	1/1	0,2	78.28
13	48953655	C	CA	RB1	Intronic	Frameshift insertion	0/1	1,6	120.73
13	48955659	C	CAA	RB1	Intronic	Frameshift insertion	0/1	1,2	73.6

Figure 4. In vitro characteristics of HCC-ZJ cells. (a) the proliferative potential of HCC-ZJ, Huh1, and HCCLM3 cells (n = 4); (b) colony formation ability of HCC-ZJ, Huh1, and HCCLM3 cells (n = 3); (c) migration and invasion abilities of HCC-ZJ, Huh1, and HCCLM3 cells (n = 3);(d) the sensitivity of HCC-ZJ, Huh1, and HCCLM3 to sorafenib (left) and lenvatinib (right) (n = 5).

Figure 5. In vivo oncogenicity of the HCC-ZJ cell line. (a) subcutaneous inoculation of 1 × 10⁶ HCC-ZJ cells; (b) subcutaneous inoculation of 1 × 10⁶ HCC-ZJ-Luc cells; the luminescence reached 1 × 10⁸ (n = 5); (c) orthotopic tumorigenesis of 1 × 10⁶ HCC-ZJ-Luc and HCCLM3-Luc cells (n = 6) in the third week; (d) luciferase activity of HCC-ZJ-Luc and HCCLM3-Luc at the indicated time point; (e) dissection of orthotopic tumors (n = 6) in the third week; (f) imaging of newly dissected lungs from HCC-ZJ-bearing and HCCLM3-bearing mice showed that orthotopic tumors of HCC-ZJ could migrate into the lung (n = 6); the first lung of each group derived from healthy mice without orthotopic inoculation of HCC cells; (g) H&E staining demonstrating the lung metastasis of orthotopic HCC-ZJ.

Data availability statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to the patient’s privacy.