One cell model establishment to inhibit CaMKII_γ mRNA expression in the dorsal root ganglion neuron by RNA interfere

Figures & data

Table 1. The primer of the shRNA.

Name of the primer	Sequence
CaMKIIγ-shRNA-1-A	5′-TTTGGGATATGCCGACTTCTGAATTCAAGACGTTCAGAAGTCGGCATATCCTTTTTTG-3′
CaMKIIγ-shRNA -1-B	5′-AGCTCAAAAAAGGATATGCCGACTTCTGAACGTCTTGAATTCAGAAGTCGGCATATCC-3′
CaMKIIγ-shRNA -2-A	5′-TTTGGGAGCCTACGATTTCCCATTTCAAGACGATGGGAAATCGTAGGCTCCTTTTTTG -3′
CaMKIIγ-shRNA -2-B	5′-AGCTCAAAAAAGGAGCCTACGATTTCCCATCGTCTTGAAATGGGAAATCGTAGGCTCC-3′
CaMKIIγ-shRNA -3-A	5′-TTTGGGTCAACAGTGGCATCCATTTCAAGACGATGGATGCCACTGTTGACCTTTTTTG-3′
CaMKIIγ-shRNA -3-B	5′-AGCTCAAAAAAGGTCAACAGTGGCATCCATCGTCTTGAAATGGATGCCACTGTTGACC-3

Underline is the sense and antisense sequence.

Figure 1. The map of pYr-1.1 plasmid.

Figure 2. pYr-1.1 plasmid digest with BASI enzyme. Lane 1: pYr-1.1 plasmid; Lane 2 Marker.

Figure 3. pYr-1.1–CaMKII_γ-shRNA plasmid digest with BASI enzyme. Lane 1. Marker. Lane 2, 3, 4 pYr-CaMKII_γ-shRNA-1 three different bacterial clones. Lane 5, 6, 7 pYr-CaMKII_γ-shRNA-2 three different bacterial clones. Lane 8, 9, 10 pYr- shRNA-CaMKII_γ-3 three different bacterial clones.

Figure 4. The sequence (underline) of the pYr-1.1-CaMKII_γ-shRNA-1, pYr-1.1-CaMKII_γ-shRNA-2 and pYr-1.1-CaMKII_γ-shRNA-3.

Figure 5. pAd-CaMKII_γ-shRNA digested. Lane 1, pAd-CaMKII_γ-shRNA-1 Lane 2, pAd-CaMKII_γ-shRNA-2.

Figure 6. PCR verify the production of recombinant adenovirus in 293 cells. Lane 1, pAd/PL-DEST vector. Lane 2, pAd-CaMKII_γ-shRNA. Lane 3, negative control.

Figure 7. Infection efficiency of the pAd-CaMKII_γ-shRNA adenovirus under fluorescence microscope, scale bar =25 μm. A: DRG cells under visible light (×20). B: DRG cells under green fluorescence (×20).

Figure 8. The expression of CaMKII_γ mRNA (mean ± sd, n = 6). *P < 0.01 versus normal DRG cells, #P < 0.01 versus empty plasmid DRG cells.

Figure 9. The expression of CaMKII_γ protein (mean ± sd, n = 6). *P < 0.01 versus normal DRG cells, #P < 0.01 versus empty plasmid DRG cells. Lane 1, the expression of CaMKII_γ protein in normal DRG cells. Lane 2, the expression of CaMKII_γ protein in empty DRG cells. Lane 3, the expression of CaMKII_γ protein in pAd-CaMKII_γ-shRNA adenovirus DRG cells.