Incidence of virulence determinants among Streptococcus agalactiae isolated from pregnant women and association with their serotypes

Figures & data

Table 1. Primer list used to amplify virulence-associated genes.

Virulence	Gene	Type	Primer Sequence (5’-3’)	Size (bp)	TM ^oC	Reference
Protein C	bac	Fw	TGTAAAGGACGATAGTGTGAAGAC	530	52	[8]
		Rv	CATTTGTGATTCCCTTTTGC
Hyaluronidate lyase	hylB	Fw	TTATCATCCAGCGCCTCCTAG	245	50	[8]
		Rv	GTGGTGATAACTGACTTCTTGGGA
laminin-binding protein	lmb	Fw	GACGCAACACACGGCAT	300	50	[8]
		Rv	TGATAGAGCACTTCCAAATTTG
C5a peptidase	scpB	Fw	AGCCATATGCTGCGATCTCT	198	56	[8]
		Rv	GGGTTGAACCAAGTGTGCTT
Hemolysin	cylB	Fw	GGGCTGCAGGTATTATCGAA	176	58	[8]
		Rv	ATTTCCACCAAAAGCAAACG
Fibrinogen binding Proteins A	fbsA	Fw	TGTAGCTAATGGACCGATGTT	156	58	[8]
		Rv	TTTTCATTGCGTCTCAAACC
Fibrinogen binding Proteins B	fbsB	Fw	ACAACTGCGGAAATGACCTC	186	57	[8]
		Rv	ACGAGCGACGTTGAATTCTT
Hypervirulent adhesion protein	hvgA	Fw	ATACAAATTCTGCTGACTACCG	120	57	[32]
		Rv	TTAAATCCTTCCTGACCATTCC
Multiplex PCR
Surface Protein Genes	Universal forward	Fw	TGATACTTCACAGACGAAACAACG		56	[33]
	alpha-C	Rv	TACATGTGGTAGTCCATCTTCACC	398
	Rib	Rv	CATACTGAGCTTTTAAATCAGGTGA	295
	Epsilon	Rv	CCAGATACATTTTTTACTAAAGCGG	200
	alp2/3	Rv	CACTCGGATTACTATAATATTTAGCAC	334
	alp 4	Rv	TTAATTTGCACCGGATTAACACCAC	130

Note: Fw : forward, Rv: reverse, bp: bae pair, Tm: melting temperature.

Table 2. Demographic characters of studied cases

Demographic data		Patients number (%) (n=92)
Age (years)
Mean ± SD		29.06±4.95 year
Min-Max		19-42 year
Age categories (years)
≤20		5 (5.4%)
21-30		54 (58.7%)
>30		33 (35.9%)
Gestational weeks
Mean ± SD		32.48±3.03
Min-Max		24-40
Residence
Balqas		39 (42.4%)
Sherbeen		24 (26.1%)
Mansoura		29 (31.5%)
Gravidity
G1		9 (9.8%)
G2		23 (25.0%)
G3		33 (35.9%)
G4		12 (13.0%)
G5		15 (16.3%)
Parity
Nullipara	P0	4 (4.3%)
Primipara	P1	27 (29.3%)
Multipara	P2	36 (39.1%)
(66.4%)	P3	18 (19.6%)
	P4	7 (7.6%)
Abortions
Positive		23 (25.0%)
Negative		69 (75.0%)
Contraceptive use
Positive		34 (37.0%)
Negative		58 (63.6%)

Figure 1. Resistance percentage of S. agalactiae isolates to different antimicrobials agents.

Figure 2. Distribution of serotypes among S. agalactiae isolates.

Table 3. Distribution of antibiotics resistance among different serotypes of S. agalactiae isolates.

Antibiotic	Serotypes (Number of resistant isolates)									P value
	Ia	Ib	II	III	IV	V	VI	VIII	Untypable
Ceftriaxone	5	3	–	12	4	3	1	2	1	MC=13.13 p=0.107
Cefepime	2	–	–	4	–	1	1	–	2	MC=13.33 P=0.101
Levofloxacin	8	3	2	14	7	4	1	3	7	MC=4.99 P=0.758
Erythromycin	11	4	5	17	11	3	1	4	7	MC=9.26 P=0.321
Chloramphenicol	5	3	3	13	6	4	1	4	6	MC=9.26 P=0.321
Clindamycin	8	6	2	19	7	6	1	1	6	MC=17.46 P=0.025*
Tetracycline	12	5	5	19	9	5	1	4	9	MC=1.83 P=0.9863
Meropenem	3	1	–	7	3	4	1	2	2	MC=11.74 P=0.163
Total number	17	7	8	24	11	7	1	5	12

Note: Used test: Monte Carlo test as exact test for correction of Chi-square in cells with observed count less than 5, *statistically significant.

Table 4. Correlation between biofilm forming capacity and different serotypes of S. agalactiae isolates.

Biofilm category	Number of isolates (%)	Serotypes (Number of isolates)
		Ia	Ib	II	III	IV	V	VI	VIII	Untypable
Strong	67 (72.8%)	11	5	5	19	8	5	1	5	8
Moderate	20 (21.7%)	6	2	3	4	2	1	—	—	2
Weak	5 (5.43%)	—	—-	—-	1	1	1	—	—	2
Total	92	17	7	8	24	11	7	1	5	12
MC=	018.89 0.007*	11.09 0.003*	2.39 0.301	1.27 0.530	46.93 <0.001*	2.45 0.293	3.73 0.155	16.92 0.002*	0.805 0.668	9.71 0.008*
P value

Note: Used test: Monte Carlo test as exact test for correction of Chi-square in cells with observed count less than 5, *statistically significant.

Table 5. Correlation between biofilm formation capacity and resistance to different antimicrobial agents among S. agalactiae isolates.

Biofilm category	Antibiotics (Number of resistant isolates)								P value
	Ceftriaxone	Cefepime	Levoflovacin	Erythromycin	Chloramphenicol	Clindamycin	Tetracyclin	Meropenem
Strong	25	9	29	46	34	45	58	18	Chi-square: 2.355 P-value:0.937
Moderate	5	1	9	13	7	9	14	4	Chi-square: 1.735 P-value:0.973
Weak	1	1	4	4	5	3	5	1	Chi-square: 2.848 P-value:0.898
Total	31	11	42	63	46	57	77	23

Table 6. Correlation between hemolysis production and different serotype among S. agalactiae isolates.

Hemolysis Percent	Number of isolates (%)	Serotypes (Number of isolates)
		Ia	Ib	II	III	IV	V	VI	VIII	Untypable
100	9 (9.7%)	—	2	2	1	2	—	—	—	2
>50 and < 100	65 (70.6%)	15	3	5	17	6	3	1	5	8
<50	18 (19.5%)	2	2	1	6	3	4	—	—	2
Total	92	17	7	8	24	11	7	1	5	12
MC= P value	X^2=0.137 0.933	3.49 0.174	3.59 0.166	2.31 0.315	1.15 0.563	1.47 0.479	6.72 0.03*	0.408 0.815	2.08 0.353	0.736 0.692

Note: Used test: Monte Carlo test as exact test for correction of Chi-square in cells with observed count less than 5, *statistically significant.

Figure 3. Electrophoretic graph of tested virulence factors encoding genes in some represented isolates of S. agalactiae. a: bac gene, b: hvgA gene, c: fsbA gene, d: fsbB gene, e: scpB gene, f: hylB, g cylB gene, h: lmb gene. M: 100bp DNA marker. C: negative control, bp: base pair.

Figure 4. Electrophoretic graph of surface anchored protein genes in some represented isolates of S. agalactiae. Alpha-C: 398bp, rib: 295bp, epsilon:200bp, alp2/3: 334bp, alp4:130bp. M: 100bp DNA marker, C: negative control.

Table 7. Profile patterns of Surface protein genes associated with S. agalactiae isolates.

Pattern	Surface proteins genes					Number of isolates (percent)
	alpha-C	rib	epsilon	alp2/3	alp4
P1	-	-	-	-	-	2 (2.17%)
P2	-	+	-	-	-	13(14.1%)
P3	-	-	+	-	-	13(14.1%)
P4	-	-	-	-	+	4(4.34%)
P5	+	+	-	-	-	3(3.2%)
P6	-	+	-	+	-	4(4.3%)
P7	-	-	-	+	+	7(7.6%)
P8	-	+	+	-	-	2(2.17%)
P9	-	-	+	-	+	4(4.34%)
P10	+	+	+	-	-	1(1.08%)
P11	-	+	+	-	+	1(1.08%)
P12	+	+	-	+	-	1(1.08%)
P13	-	-	+	+	+	7(7.6%)
P14	-	+	-	+	+	6(6.5%)
P15	-	+	+	+	+	22(23.9%)
P16	+	+	-	+	+	1(1.08%)
P17	+	+	+	+	+	1(1.08%)

Table 8. Correlation between the tested virulence genes and different serotypes among S. agalactiae isolates.

Virulence genes	Serotypes Number of isolates									P value
	Ia	Ib	II	III	IV	V	VI	VIII	Untypable
fbsA	17	7	7	24	11	7	0	5	12	0.006*
fbsB	16	7	8	23	11	7	0	5	12	0.917
bac	17	6	7	13	7	6	1	5	4	0.001*
hylB	11	6	5	20	10	7	0	3	1	≤0.001*
cylB	15	7	8	23	9	6	1	5	12	0.533
lmb	16	7	8	23	11	7	1	5	9	0.170
scpB	16	7	7	24	11	7	0	5	12	0.018*
hvgA	7	2	6	21	4	4	0	4	5	0.006*
alphaC	0	1	3	1	1	1	0	0	0	0.118
rib	13	4	6	19	2	5	0	4	3	0.001*
epsilon	16	0	3	11	9	6	1	4	2	≤0.001*
alp 2/3	14	4	5	12	1	5	0	4	7	0.009*
alp 4	15	3	5	12	2	4	1	4	7	0.028*
Total number	17	7	8	24	11	7	1	5	12	-

Note: *Statistically significant.

Table 9. Correlation between virulence genes and biofilm forming capacity among S. agalactiae isolates.

Virulence genes	Biofilm category (Number of isolates)						P value
	Strong		Mordent		Weak
	+	-	+	-	+	-
fbsA	65	2	20	–	5	–	0.682
fbsB	64	3	20	–	5	–	0.560
bac	45	22	16	4	2	3	0.205
hylB	48	19	13	7	1	4	0.037*
cylB	62	5	18	2	5	–	0.749
lmb	66	1	18	2	5	–	0.156
scpB	60	7	19	1	5	–	0.582
hvgA	37	30	11	9	2	3	0.802
alphaC	5	62	3	17	–	5	0.448
rib	42	25	12	8	2	3	0.602
epsilon	36	31	12	8	2	3	0.710
alp 2/3	36	31	9	11	4	1	0.369
alp 4	41	26	10	10	3	2	0.670
Total number	67		20		5

Note: Used test: Monte Carlo test as exact test for correction of Chi-square in cells with observed count less than 5, *statistically significant.

Bobadilla FJ, Novosak MG, Cortese IJ, et al. Prevalence, serotypes and virulence genes of streptococcus agalactiae isolated from pregnant women with 35–37 weeks of gestation. BMC Infect Dis. 2021;21(1):73. doi: 10.1186/s12879-020-05603-5

 PubMed Web of Science ®Google Scholar

Teatero S, McGeer A, Low DE, et al. Characterization of invasive group b streptococcus strains from the greater toronto area canada. J Clin Microbiol. 2014;52(5):1441–1447. doi: 10.1128/JCM.03554-13

 PubMed Web of Science ®Google Scholar

Sadeh M, Firouzi R, Derakhshandeh A, et al. Molecular characterization of streptococcus agalactiae isolates from pregnant and non-pregnant women at yazd university hospital, iran jundishapur. J Microbiol. 2016;9(2):e30412–e30412. doi: 10.5812/jjm.30412

 Web of Science ®Google Scholar