Effects of some flavor enhancer food additives on expression of cancer-related genes in MCF-7 and MCF-12A cells

Figures & data

Table 1. Gene information in the NCBI database, sequences and melting temperatures of primers designed for use in qRT-PCR

Genes/ Primers name	Length	Gene Bank Number	Sequence (5’-3’)	Tm (°C)
CYP1A1	2586 bp	BC_023019.1	F:GAACATCCCTATTCTTCGGGG	58–60 °C
			R: GCCATGTGGCCCTTCTGTC
BCL-2α	6492 bp	NM_000633.2	F: CCGTGGGATGCCTTTGACC	58–60 °C
			R: CGGAAACTGAGCAGAGTGGT
β-Actin	1812 bp	NM_001101.5	F: GGAGGCACCCAGCACTTA	58–60 °C
			R: GCCGATCCACACGGAGTTGA

Table 2. MTT results of MSG, MPG and MDG treatment on MCF-7 and MCF-12A cell lines

	MCF-7				MCF-12A
MSG	Con (mM)	Absorb	% Viability	IC50 (mM)	Con (mM)	Absorb	% Viability	IC50 (mM)
	Control	1.78	100	227.17	Control	2.23	100	156.53
	437.50*	1.17	65.50		437.50*	1.22	54.68
	218.75	1.55	87.20		218.75	1.08	48.40
	109.37	1.41	79.16		109.37	1.11	49.75
	54.68	1.38	77.37		54.68	1.29	57.82
	27.34	1.14	63.96		27.34	1.04	46.61
	Control	1.62	100	84.64	Control	1.62	100	197.24
MPG	218.75*	0.89	54.65		218.75*	0.74	45.68
	109.37	0.90	55.56		109.37	0.76	46.91
	54.68	0.96	59.17		54.68	0.70	43.21
	27.34	0.64	39.78		27.34	0.63	38.89
	13.67	0.66	40.96		13.67	0.59	36.42
	Control	1.39	100	80.27	Control	1.39	100	14.05
MDG	109.30*	0.72	51.59		109.30*	0.83	59.71
	54.65	0.74	52.96		54.65	0.81	58.27
	27.33	0.74	53.00		27.33	0.89	64.03
	13.66	0.72	51.84		13.66	0.72	51.80
	6.83	0.79	56.56		6.83	0.75	53.96

Con: Concentration, Absorb: Absorbance, * Most effective concentration.

Table 3. Mean, standard deviation and standard error of CYP1A1 and BCL-2 gene expression data obtained as a result of normalization of MCF-7 and MCF-12A cells

		Mean				Standard Deviation				Standard Error
		BCL-2		CYP1A1		BCL-2		CYP1A1		BCL-2		CYP1A1
	Con. (mM)	MCF7	MCF 12A	MCF7	MCF 12A	MCF7	MCF 12A	MCF7	MCF 12A	MCF7	MCF 12A	MCF7	MCF 12A
MSG	C	1	1	1	1	-	-	-	-	-	-	-	-
	437,5	2,309	0,631	0,545	2,183	1,657	0,282	0,072	0,290	0,956	0,162	0,042	0,167
MPG	C	1	1	1	1	-	-	-	-	-	-	-	-
	218,7	1,188	0,477	0,428	5,126	0,856	0,151	0,195	0,638	0,494	0,087	0,113	0,368
MDG	C	1	1	1	1	-	-	-	-	-	-	-	-
	109,3	1,200	0,938	0,767	1,292	0,384	0,254	0,041	0,492	0,221	0,147	0,023	0,284

Con: Concentration, C: Control.

Figure 1. Concentration-related changes in the expression levels of CYP1A1 and BCL-2 genes determined in MSG-treated MCF-7 (breast cancer) and MCF-12A (normal breast epithelium) cell lines.

Figure 2. Concentration-related in the expression levels of CYP1A1 and BCL-2 genes determined in MPG-treated MCF-7 (breast cancer) and MCF-12A (normal breast epithelium) cell lines.

Figure 3. Concentration-related changes in the expression levels of CYP1A1 and BCL-2 genes determined in MDG-treated MCF-7 (breast cancer) and MCF-12A (normal breast epithelium) cell lines.