Melatonin bio-synthesizing enzyme genes (Tph1, Aanat1, Aanat2, and Hiomt) and their temporal pattern of expression in brain and gut of a tropical carp in natural environmental conditions

Figures & data

Table 1. The average day length and water temperature in four seasons from where fish were collected (latitude 24°44′N, longitude 93°58′E)

Seasons	Sunrise (h)	Sunset (h)	Day length (h)	Water temperature (°C)
Preparatory	5.5	17.08	11:18	15.0
Pre-spawning	4.44	17.41	13:00	28.3
Spawning	4.49	17.48	13:00	26.0
Post-spawning	5.35	16.25	10:50	18.5

Table 2. Details about primer sequences used for RT-qPCR for Tph1, Aanat1, Aanat2, and Hiomt in the brain and gut of Catla catla

Name of the genes	Primer	Primer sequences	Amplicon (bp)	Sequence ID
Tryptophan hydroxylase 1	qPCR Tph1-F	GCGGATCATCCAGGATTC	121	KR024229.1
	qPCR Tph1-R	CCTCTTCCTCTGTGAACTC
Arylalkylamine N-acetyltransferase 1	qPCR Aanat1-F	GGCAGTCCACCGGACCTT	58	KR024226.1
	qPCR Aanat1-R	GTAACGCCACAGCAGGATAG
Arylalkylamine N-acetyltransferase 2	qPCR Aanat2-F	TCTGTGCACCGCCACTGT	54	KR024227.1
	qPCR Aanat2-R	GCGCCAAAGCAAGATGGA
Hydroxyindole-O-methyltransferase	qPCR Hiomt-F	CGCAAGACGAGCGCATCT	58	KR024228.1
	qPCR Hiomt-R	TGCGGGAGCTCGTCCTTA
Beta Actin	qPCR Actb-F	GACACAGATCATGTTCGAGACCTT	59	JQ991014.1
	qPCR Actb-R	CAGCCTGGATGGCAACGT

Figure 1. Seasonal and light–dark phase changes in the expression level of (A) Tph1 in Brain, (B) Tph1 in Gut and (C) Aanat1 in Brain, (D) Aanat1 in Gut were compared by taking the mean value of three time points during the light phase (represented by empty circle) and the dark phase (represented by filled circle).

Notes: Statistical analysis for brain Tph1 expression was done by Kruskal–Wallis Test followed by Bonferroni. One-way ANOVA followed by Tukey’s test were used to analyze gut Tph1, brain Aanat1, and gut Aanat1. Bar in the graph indicates mean ± S.E.M. Group sharing common letters has no statistical difference. All statistical analyses were conducted at 0.05 level of significance.

Figure 2. Seasonal and light–dark phase changes in the expression level of (A) Aanat2 in Brain, (B) Aanat2 in Gut and (C) Hiomt in Brain, (D) Hiomt in Gut were compared by taking the mean value of three time points during the light phase (represented by empty circle) and the dark phase (represented by filled circle).

Notes: Statistical analysis was done by one-way ANOVA followed by Tukey’s test. Bar in the graph indicates mean ± S.E.M. Group sharing common letters has no statistical difference. All statistical analyses were conducted at 0.05 level of significance.

Figure 3. Changes in the expression of Tph1 in six different time points (8, 12, 16, 20, 24, and 4 h) in different seasons (n = 3) were fitted to nonlinear regression curve using the formula “Y = Mesor + Amplitude Cos (Frequency X + Acrophase)”.

Notes: Cosinor analysis was performed to obtain the rhythm parameters and the existence of rhythm. p-value < 0.05 is considered as significant.

Table 3. Correlations study between water temperature and expression level

Tissue	Gene	Correlations coefficient	p-value
Brain	Tph1	−0.682^*	0.005 (except preparatory phase)
	Aanat1	−0.315	0.130
	Aanat2	−0.943^*	0.000
	Hiomt	−0.608^*	0.004
Gut	Tph1	−0.533^*	0.011
	Aanat1	−0.716^*	0.001
	Aanat2	−0.633^*	0.003
	Hiomt	−0.237	0.256

^* p-value < 0.05 is considered as significant.

Figure 4. Changes in the expression of Aanat1 in six different time points (8, 12, 16, 20, 24, and 4 h) in different seasons (n = 3) were fitted to nonlinear regression curve using the formula “Y = Mesor + Amplitude Cos (Frequency X + Acrophase)”.

Notes: Cosinor analysis was performed to obtain the rhythm parameters and the existence of rhythm. p-value < 0.05 is considered as significant.

Figure 5. Changes in the expression of Aanat2 in six different time points (8, 12, 16, 20, 24, and 4 h) in different seasons (n = 3) were fitted to nonlinear regression curve using the formula “Y = Mesor + Amplitude Cos (Frequency X + Acrophase)”.

Notes: Cosinor analysis was performed to obtain the rhythm parameters and the existence of rhythm. p-value < 0.05 is considered as significant.

Figure 6. Changes in the expression of Hiomt in six different time points (8, 12, 16, 20, 24, and 4 h) in different seasons (n = 3) were fitted to nonlinear regression curve using the formula “Y = Mesor + Amplitude Cos (Frequency X + Acrophase)”.

Notes: Cosinor analysis was performed to obtain the rhythm parameters and the existence of rhythm. p-value < 0.05 is considered as significant.

Figure 7. In vivo and in vitro melatonin synthesis in (A) Brain and (B) Gut tissues was analyzed by two-way analysis of variance followed by Student–Newman–Keuls.

Notes: The values are represented by circle and the bar in the graph indicates mean ± S.E.M with n = 3. p-value < 0.05 is considered as significant.