Analysis of the relationship between geography and body color with the genetic diversity in the Echiura worm Urechis unicinctus based on the mitochondrial COI and D-loop sequences

Figures & data

Figure 1. Locations of five sampling sites of U. unicinctus. (Dalian black, DB, 121°36′59.71″E, 39°09′59.15″N; Dalian red, DR, 121°28′32.60″E, 39°43′22.83″N; Hebei purple, HP, 119°12′08.52″E, 39°20′41.66″N; Hebei black, HB, 119°07′56.54″E, 39°16′45.39″N; Shandong red, SR, 121°48′40.20″E, 37°27′45.26″N).

Figure 2. Photographs of Urechis unichinctus with different body colors. (a) Purple, (b) black, and (c) red.

Table 1. The numbers and average weights of U. unicinctus among different geographies and body colors.

Population	Numbers	Average weight (g)
DB	31	102
DR	34	108
HB	30	135
HP	34	56
SR	33	40

Table 2. The primer information and thermal cycling for COI gene and D-loop region.

Target	Primer information		Thermal cycling
COI gene	COI-1F	G(A/G)TT(C/T)GGAAACTGATTAGTTCCC	94 °C 5 min; 10 cycles for 94 °C 30 s, 65 °C 30 s (−0.5 °C/cycles), and 72 °C 40 s; 25 cycles for 94 °C 30 s, 60 °C 30 s, and 72 °C 40 s; 72 °C 3 min.
	COI-2F	CTTGGGGCACC(A/T)GA(T/C)ATAGCATTC
	COI-1R	AAGTATGCCCCGTGTGTCTACATC
D-loop region	U6-F	ATTAAACGTATTGTGC	94 °C 5 min; 33 cycles for 94 °C 30 s, 50 °C 30 s, and 72 °C 30 s; 72 °C 3 min.
	U6-R	TTAGAGGCGGAGTTA

Table 3. Genetic diversity parameters for five populations of U. unicinctus based on COI/D-loop sequences.

Population	Numbers	h	S	Hd	Pi	Tajima’s D	Fu’s Fs
DB	29/31	21/15	37/26	0.956/0.770	0.013/0.016	−1.685/−2.244*	−11.074/−7.940*
DR	34/30	24/11	40/21	0.954/0.768	0.012/0.012	−1.977*/−2.260*	−15.115*/−4.300*
HB	30/30	19/13	51/20	0.961/0.894	0.013/0.018	−2.229*/−1.541	−7.620*/−4.624
HP	34/32	25/19	36/38	0.970/0.863	0.012/0.019	−1.699/−2.515*	−17.550/−12.643*
SR	33/32	25/16	35/20	0.973/0.810	0.010/0.014	−1.931*/−1.877*	−20.461*/−10.224
All	160/155	83/52	93/58	0.970/0.824	0.012/0.016	−2.336*/−2.447*	−33.479*/−61.319*

*Significant at level (p < 0.05). Numbers means the numbers of COI or D-loop sequences for diversity analyses.

h, haplotypes; S, number of polymorphic sites, Hd, haplotype diversity; and Pi, nucleotide diversity.

Figure 3. Maximum likelihood tree constructed based on 83 COI haplotypes (a) and 52 D-loop haplotypes of U. unicinctus. Numbers on the branches are bootstrap values for maximum likelihood.

Table 4. Pairwise Kimura 2-parameter distance between different populations based on COI (above diagonal) and D-loop (below diagonal) sequences.

Population	DB	DR	HB	HP	SR
DB	0.0131/0.0166	0.0126	0.0134	0.0123	0.0117
DR	0.0145	0.0119/0.0128	0.0129	0.0121	0.0111
HB	0.0165	0.0146	0.0138/0.0166	0.0128	0.0120
HP	0.0187	0.0169	0.0184	0.0118/0.0207	0.0111
SR	0.0155	0.0141	0.0155	0.0175	0.0100/0.0143

Values in the diagonal with a bold font are the K2-P distances within populations based on COI/D-loop sequences.

Table 5. Molecular variance (AMOVA) analysis among five of U. unicinctus based on COI sequences.

Source of variation	d.f.	Sum of squares	Variance components	Percentage of variation
Among populations	4	12.475	0.01656 Va	0.64
Within populations	155	401.375	2.58951 Vb	99.36
Total	159	413.850	2.60607	100

Fixation Index F_ST: 0.0635; p-value: 0.13685 ± 0.00941. d.f. means degree of freedom.

Table 6. Molecular variance (AMOVA) analysis among five of U. unicinctus based on D-loop sequences.

Source of variation	d.f.	Sum of squares	Variance components	Percentage of variation
Among populations	4	5.045	0.00055 Va	0.04
Within populations	151	187.865	1.24414 Vb	99.96
Total	155	192.910	1.24469	100

Fixation Index F_ST: 0.00044; p-value: 0.41935 ± 0.01326. d.f. means degree of freedom.

Data availability statement

The data that support the findings of this study are available in GenBank at https://www.ncbi.nlm.nih.gov/nuccore/, reference numbers MT346032-MT346374.