The first complete mitogenome of skin beetles Omorgus chinensis (Coleoptera: Trogidae) with the phylogenetic implications

Figures & data

Table 1. Details on primers used in this study.

Gene	Prime name	Sequence(5’-3’)	Length	References
COI	COI-F1	CAACATTTATTTTGATTTTTTGG	23 bp	Simon et al. (1994)
	COI-R1	TCCAATGCACTAATCTGCCATATTA	25 bp	Simon et al. (1994)
Cytb	Cytb-F2	GAGGAGCAACTGTAATTACTAA	22 bp	Balke et al. (2004)
	Cytb-R2	AAAAGAAARTATCATTCAGGTTGAAT	26 bp	Balke et al. (2004)
rrnL	16S-F1	CCGGTTTGAACTCAGATCATG	21 bp	Hosoya et al. (2001)
	16S-R1	TAATTTATTGTACCTTGTGTATCAG	25 bp	Hosoya et al. (2001)

Table 2. Taxa used in this study.

Family	Species	GenBank accession number
Aphodiidae	Aphodius foetens	KX087240
Cetoniidae	Protaetia brevitarsis	NC023453
Dynastidae	Cyphonistes vallatus	JX412731
Euchiridae	Cheirotonus jansoni	NC023246
Geotrupidae	Anoplotrupes stercorosus	JX412838
Hybosoridae	Ceratocanthus sp.	JX412772
Lucanidae	Cyclommathus vitalisi	MF037205
	Dorcus curvidens hopei	MF612067
	Lucanus fortunei	JX313688
	Lucanus mazama	NC013578
	Prismognathus prossi	MF614014
	Prosopocoilus confucius	KU552119
	Prosopocoilus gracilis	KP735805
Melolonthidae	Rhopaea magnicornis	NC013252
Rutelidae	Popillia japonica	MG971231
Scarabaeidae	Onthophagus yukae	KU739463
Sinodendridae	Sinodendron yunnanense	KP735804
Trogidae	Omorgus chinensis*	MK937809

*Mitochondrial genome sequenced in present study.

Table 3. Mitogenome organization of Omorgus chinensis.

Gene	Strand	Region	Length (bp)	Start codon	Stop codon	Anti-codon	Intergenic nucleotides (bp)
trnI-Ile	J	1–66	66	–	–	GAT	2
trnQ-Gln	N	69–137	69	–	–	TTG	5
trnM-Met	J	143–211	69	–	–	CAT	0
nad2	J	212–1225	1014	ATT	TAA	–	9
trnW-Trp	J	1235–1302	68	–	–	TCA	−8
trnC-Cys	N	1295–1357	63	–	–	GCA	0
trnY-Tyr	N	1358–1422	65	–	–	GTA	1
COI	J	1424–2959	1536	AAT	TAA	–	−5
trnL(UUR)-Leu	J	2955–3018	64	–	–	TAA	−2
COII	J	3017–3704	688	ATG	T	–	0
trnK-Lys	J	3705–3776	72	–	–	CTT	4
trnD-Asp	J	3781–3847	67	–	–	GTC	0
atp8	J	3848–4003	156	ATT	TAA	–	−4
atp6	J	4000–4671	672	ATA	TAA	–	−1
COIII	J	4671–5458	788	ATG	TA	–	−1
trnG-Gly	J	5458–5523	66	–	–	TCC	0
nad3	J	5524–5877	354	ATT	TAG	–	−2
trnA-Ala	J	5876–5942	67	–	–	TGC	0
trnR-Arg	J	5943–6009	67	–	–	TCG	−1
trnN-Asn	J	6009–6074	66	–	–	GTT	0
trnS(AGN)-Ser	J	6075–6140	66	–	–	TCT	1
trnE-Glu	J	6142–6204	63	–	–	TTC	−2
trnF-Phe	N	6203–6268	66	–	–	GAA	−1
nad5	N	6268–7988	1721	ATT	TA	–	0
trnH-His	N	7989–8053	65	–	–	GTG	−1
nad4	N	8053–9390	1338	ATG	TAA	–	−7
nad4L	N	9384–9674	291	ATG	TAA	–	2
trnT-Thr	J	9677–9739	63	–	–	TGT	0
trnP-Pro	N	9740–9804	65	–	–	TGG	1
nad6	J	9806–10309	504	ATC	TAA	–	0
Cytb	J	10310–11458	1149	ATA	TAG	–	−2
trnS(UCN)-Ser	J	11457–11522	66	–	–	TGA	18
nad1	N	11541–12491	951	ATT	TAG	–	0
trnL(CUN)-Leu	N	12492–12555	64	–	–	TAG	0
rrnL	N	12556–13855	1300	–	–	–	0
trnV	N	13856–13925	70	–	–	TAC	0
rrnS	N	13926–14676	751	–	–	–	0
Control region	–	14677–18682	4006	–	–	–	0

Figure 1. The ML and BI phylogenetic trees of Omorgus chinensis and 17 other scarabs based on 13 PCGs.

Data availability statement

The genome sequence data that support the findings of this study are openly available in GenBank of NCBI at [https://www.ncbi.nlm.nih.gov] (https://www.ncbi.nlm.nih.gov/) under the accession MK937809. The associated BioProject, Bio-Sample numbers and SAR number are PRJNA759651, SAMN21181119 and SRR 16510902, respectively.