Novel diversity in mitochondrial genomes of deep-sea Pennatulacea (Cnidaria: Anthozoa: Octocorallia)

Figures & data

Table 1. Collection information, museum vouchers, and GenBank Accession numbers for samples used herein.

Species	Depth (m)	Location	Accession Number	Genbank Number
Anthoptilum grandiflorum	1,150	Greenland	NMS.Z.2019.25.16	MK91965
Anthoptilum sp. 1	3,148	Whittard Canyon	NMS.Z.2019.25.1	MK919656
Distichoptilum gracile	2,350	Whittard Canyon	NMS.Z.2019.25.2	MK919657
Funiculina quadrangularis	15-40	Little Loch Broom, Scotland	NMS.Z.2019.25.17	MK919658
Halipteris cf. finmarchica	1,891	Whittard Canyon	NMS.Z.2019.25.3	MK919659
Kophobelemnon sp. 1	1,113	Whittard Canyon	NMS.Z.2019.25.4	MK919660
Kophobelemnon sp. 3	1,606	Whittard Canyon	NMS.Z.2019.25.5	MK919661
Kophobelemnon sp. 4	760	Whittard Canyon	NMS.Z.2019.25.6	MK919662
Pennatula aculeata	1,726	Whittard Canyon	NMS.Z.2019.25.7	MK919663
Pennatula cf. aculeata	1,000	Bay of Biscay		MK919664
Pennatula cf. inflata	1,830	Whittard Canyon	NMS.Z.2019.25.8	MK919665
Pennatula grandis	1,338	Whittard Canyon	NMS.Z.2019.25.9	MK919666
Protoptilum carpenteri	965	Whittard Canyon	NMS.Z.2019.25.10	MK919667
Umbellula huxleyi	1,772	Whittard Canyon	NMS.Z.2019.25.11	MK919668
Umbellula sp. 1	2,322	Whittard Canyon	NMS.Z.2019.25.12	MK919669
Umbellula sp. 2	1,708	Porcupine Bank, Ireland	NMS.Z.2019.25.13	MK919670
Umbellula sp. 3	4,173	Whittard Canyon	NMS.Z.2019.25.14	MK919672 (13kb) MK919671 (5 kb)
Virgularia mirabilis	7	Galway Bay, Ireland	NMS.Z.2019.25.15	MK919673

Table 2. PCR primers for Sanger sequencing across gene junctions. *Modified slightly from cited publication.

Primer	Binding Region	Sequence	Author
13F	mtMutS	ctattttaggytggaagaga	Park et al. (2010)
13R	rnl	ctgtttccaagcctactt	Park et al. (2010)
ND42599F	nad4L	gccattatggttaactattac	France and Hoover (2002)
Mut3458R	mtMutS	tsgagcaaaagccactcc	Sánchez et al. (2003)
16S647F	rnl	acacagctcggtttctatctacaa*	McFadden et al. (2006)
msh2806R	mtMutS	taacccagcttgggagtgtgc*	Brugler & France (2008)
COII8068F	cox2	ccataacaggactagcagcatc	McFadden et al. (2006)
COI8325R	cox1	tccttatgattagtagaaaa	McFadden et al. (2006)
cobPenF	cob	ttaggagccaacccggtaga	this study
nad6PenR	nad6	tagctcctaccatggcgact	this study
ND4gen4974F	nad4	taggcttatttactcatacgat*	Brugler and France (2008)
CO3bam5657F	cox3	gctgctagttggtattggcat	Brugler and France (2008)

Table 3. Pennatulacea samples and NGS data details used in this study.

Species	Reads	Clean	MtDNA (bp)	Coverage mean (min–max)	Gene Order
Anthoptilum grandiflorum	3,981,221	3,416,102	19,391	73 (39–114)	B
Anthoptilum sp. 1	2,656,633	2,287,755	18,850	16 (5–32)	B
Distichoptilum gracile	4,675,062	3,891,766	19,171	63 (42–88)	A
Funiculina quadrangularis	5,665,947	4,786,607	18,906	270 (191–351)	A
Halipteris cf. finmarchica	2,684,606	2,320,553	18,513	25 (5–44)	A
Kophobelemnon sp. 1	3,064,336	2,542,074	18,883	40 (20–61)	A
Kophobelemnon sp. 3	2,460,329	2,084,735	19,109	33 (12–57)	A
Kophobelemnon sp. 4	2,222,497	1,847,321	19,130	36 (16–63)	A
Pennatula aculeata	3,475,982	3,013,797	18,715	75 (34–129)	A
Pennatula cf. aculeata	3,062,179	2,550,313	18,715	128 (82–170)	A
Pennatula cf. inflata	5,033,535	4,199,539	19,127	111 (74–153)	A
Pennatula grandis	3,472,717	2,991,151	18,973	122 (69–179)	A
Protoptilum carpenteri	736,848	615,240	18,729	21 (6–38)	A
Umbellula huxleyi	1,973,389	1,656,462	18,927	45 (19–81)	A
Umbellula sp. 1	3,745,361	3,137,577	18,714	68 (40–94)	G (new)
Umbellula sp. 2	4,205,005	3,622,094	18,767	32 (12–54)	A
Umbellula sp. 3 _ 13k	1,209,061	1,011,587	12,938	41 (22–77)	Contig i
Umbellula sp. 3 _ 5k	1,209,061	1,011,587	5,579	22 (10–40)	Contig ii
Virgularia mirabilis	1,863,469	1,617,766	18,770	38 (9–74)	A

Table 4. Pennatulacea mitochondrial gene lengths (base pairs), intergenic regions (positive values) and overlapping genes (negative values) (base pairs) in specimens in this study with gene order A. Intergenic regions are represented in italics.

Genes	Distichoptilum gracile	Funiculina quadrangularis	Halipteris cf. finmarchica	Kophobelemnon sp. 1	Kophobelemnon sp. 3	Kophobelemnon sp. 4	Pennatula aculeata	Pennatula cf. aculeata
cox2-cox1	124	124	61	124	124	124	124	124
cox1	1566	1566	1563	1566	1566	1566	1566	1566
cox1-rns	37	37	27	37	37	37	37	37
rns	1057	1057	1065	1057	1057	1058	1057	1057
rns-nad1	51	51	45	52	52	63	33	33
nad1	981	981	1068	981	981	981	1092	1092
nad1-cob	−94	−94	−95	−94	−94	−94	−119	−119
cob	1266	1266	1188	1266	1266	1266	1185	1185
cob-nad6	18	18	26	18	18	18	18	18
nad6	555	555	546	555	555	555	555	555
nad6-nad3	64	64	40	64	64	64	23	23
nad3	354	354	354	354	354	354	354	354
nad3-nad4L	3	3	3	3	3	3	3	3
nad4L	294	294	294	294	294	294	294	294
nad4L-mtMutS	13	13	13	13	13	13	13	13
mtMutS	2961	2955	2940	2955	2955	2955	2994	2994
mtMutS-rnl	154	154	−28	154	154	154	154	154
rnl	1788	1788	2066	1766	1765	1783	1788	1788
rnl-nad2	64	37	−68	37	37	37	64	64
nad2	1356	1380	1365	1380	1380	1380	1356	1356
nad2-nad5	−13	−13	−13	−13	−13	−13	−13	−13
nad5	1818	1818	1815	1818	1818	1818	1818	1818
nad5-nad4	−33	−33	−17	−28	−28	−28	−33	−33
nad4	1449	1449	1449	1449	1449	1449	1449	1449
nad4-trnM	566	345	63	296	523	504	117	117
trnM	71	71	71	71	71	71	71	71
trnM-cox3	50	64	48	64	64	64	64	64
cox3	786	786	786	786	786	786	786	786
cox3-atp6	57	45	44	57	57	57	57	57
atp6	708	708	708	708	708	708	708	708
atp6-atp8	20	17	20	33	33	33	20	20
atp8	216	216	216	216	216	216	216	216
atp8-cox2	38	28	30	28	28	38	38	38
cox2	762	762	789	762	762	762	762	762
Total IGR (bP)	1259	1000	420	980	1207	1209	765	765
% IGR/mtgen	6.57	5.29	2.27	5.19	6.32	6.32	4.09	4.09
#ol genes	3	3	5	3	3	3	3	3
% pcg	79	80	81	80	79	79	81	81

Table 4. Continued.

Genes	Pennatula cf. inflata	Pennatula grandis	Protoptilum carpenteri	Umbellula. huxleyi	Umbellula sp. 2	Virgularia mirabilis
cox2-cox1	124	124	124	73	101	102
cox1	1566	1566	1566	1566	1566	1566
cox1-rns	37	37	37	49	37	37
rns	1057	1057	1057	1062	1059	1056
rns-nad1	33	33	51	65	51	51
nad1	999	999	981	963	981	981
nad1-cob	−94	−94	−94	15	−94	−94
cob	1275	1275	1266	1593	1266	1266
cob-nad6	400	246	18	1	18	18
nad6	555	555	555	573	555	555
nad6-nad3	64	64	64	−14	64	64
nad3	354	354	354	381	354	354
nad3-nad4L	3	3	3	3	3	3
nad4L	294	294	294	294	294	294
nad4L-mtMutS	13	13	13	6	13	13
mtMutS	2967	2967	2970	2925	2961	2991
mtMutS-rnl	155	155	154	154	157	154
rnl	1788	1788	1765	1760	1769	1799
rnl-nad2	65	65	37	41	65	80
nad2	1356	1356	1383	1374	1356	1356
nad2-nad5	−13	−13	−13	−13	−13	−13
nad5	1818	1818	1818	1815	1818	1815
nad5-nad4	−33	−33	−33	−20	−33	−28
nad4	1449	1449	1449	1449	1449	1449
nad4-trnM	123	123	123	63	204	118
trnM	71	71	71	71	71	71
trnM-cox3	50	50	64	68	50	64
cox3	786	786	786	828	786	786
cox3-atp6	57	57	57	5	50	57
atp6	708	708	708	708	708	708
atp6-atp8	20	20	20	17	20	23
atp8	216	216	216	216	216	216
atp8-cox2	38	38	38	15	38	42
cox2	762	762	762	783	762	762
Total IGR (bp)	1182	1028	803	546	871	826
% IGR/mtgen	6.18	5.42	4.29	2.88	4.64	4.40
#ol genes	3	3	3	3	3	3
% pcg	79	80	81	82	80	80

IGR: intergenic region; #ol genes: number of overlapping genes; pcg: protein-coding genes. OriH and OriL indicated by bold and underline, respectively.

Figure 1 Pennatulacea mitochondrial genome arrangements (linearized). Gene order A (octocoral ancestral gene order): 14 pennatulacean species of our study (Table 1). Gene order B: Anthoptilum spp. New gene order (G): Umbellula sp. 1. Bipartite mitochondrial genome: Umbellula sp. 3. Different colors correspond to the four octocoral conserved gene blocks (block 1, red: cox1–rns–nad1–cob; block 2, blue: nad6–nad3–nad4l; block 3, yellow: mtMutS–rnl–nad2–nad5–nad4; block 4, green: trnM–cox3–atp6–atp8–cox2). Arrows indicate the direction of replication. Highlighted lines mark gene block transcript direction that differ from the ancestral gene order (A).

Table 5. Pennatulacea mitochondrial gene lengths (base pairs), intergenic regions (positive values) and overlapping genes (negative values) (base pairs) in specimens in this study with gene order B (Anthoptilum spp.), G (Umbellula sp. 1) and the bipartite genome (Umbellula sp. 3).

Genes	Anthoptilum grandiflorum	Anthoptilum sp. 1	Genes	Umbellula sp. 1	Umbellula sp. 3 (contig i)	Umbellula sp. 3 (contig ii)
cox2-cox1	61	60	cox2-cox1	73	73
cox1	1566	1566	cox1	1569	1569
cox1-rns	37	37	cox1-rns	33	33
rns	1064	1059	rns	1060	1062
rns-nad1	53	52	rns-nad1	80	89
nad1	981	981	nad1	963	960
nad1-cob	−94	−94	nad1-cob	15	17
cob	1266	1266	cob	1215	1185
cob-;nad6	18	18	cob-nad6	−8	−8
nad6	555	555	nad6	579	579
nad6-nad3	63	64	nad6-nad2	13	13
nad3	354	354	nad2	1347	1347
nad3-nad4L	3	3	nad2-nad5	−13	−13
nad4L	294	294	nad5	1824	1824
nad4L-nad4	122	122	nad5-nad4	1	1
nad4	1449	1449	nad4	1449	1449
nad4-nad5	26	26	nad4-mtMutS /rnl-mtMutS	0		154*
nad5	1818	1818	mtMutS	3051		2940
nad5-nad2	−13	−13	mtMutS-nad4L	6		6
nad2	1350	1350	nad4L	294		294
nad2-rnl	73	85	nad4L-nd3	3		3
rnl	1799	1787	nad3	354		354
rnl-mtMutS	154	154	nd3-rnl	64		114*
mtMutS	2946	2946	rnl	1763		1764
mtMutS-trnM	187	186	rnl-trnM / nad4-trnM	293	74
trnM	71	71	trnM	71	71
trnM-cox3	55	58	trnM-cox3	44	44
cox3	786	786	cox3	660	660
cox3-atp6	57	57	cox3-atp6	178	178
atp6	708	708	atp6	708	708
atp6-atp8	24	24	atp6-atp8	17	17
atp8	216	216	atp8	216	216
atp8-cox2	42	42	atp8-cox2	15	15
cox2	762	762	cox2	777	777
Total IGR (bp)	975	988		835	554	271
% IGR/mtgen	5.17	5.24		34.18	4.28	4.86
#ol genes	2	2		2	2	0
% pcg	80	80		80	87	53

Intergenic regions are represented in italic. Abbreviations: IGR, intergenic region; #ol genes, number of overlapping genes; pcg, protein-coding genes. OriH and OriL indicated by bold and underline respectively.

^* possible origin of replication.

Table 6. Mitochondrial genome nucleotide composition of Pennatulacea of this study.

Species	A:	C:	G:	T:	GC:	GC Skew	AT Skew	%GC	Gene order
Anthoptilum grandiflorum	5974	3365	3579	5935	6944	0.03	0.00	36.8	B
Anthoptilum sp. 1	5977	3370	3582	5921	6952	0.03	0.00	36.9	B
Distichoptilum gracile	5624	3367	3869	6311	7236	0.07	−0.06	37.7	A
Funiculina quadrangularis	5630	3212	3720	6307	6934	0.07	−0.06	36.7	A
Halipteris cf. finmarchica	5534	3126	3633	6220	6759	0.08	−0.06	36.5	A
Kophobelemnon sp. 1	5617	3249	3730	6287	6979	0.07	−0.06	37.0	A
Kophobelemnon sp. 3	5688	3293	3772	6356	7065	0.07	−0.06	37.0	A
Kophobelemnon sp. 4	5720	3276	3774	6360	7050	0.07	−0.05	36.9	A
Pennatula aculeata	5523	3246	3724	6222	6970	0.07	−0.06	37.2	A
Pennatula cf. aculeata	5523	3251	3717	6224	6968	0.07	−0.06	37.2	A
Pennatula cf. inflata	5624	3338	3825	6340	7163	0.07	−0.06	37.4	A
Pennatula grandis	5593	3301	3786	6293	7087	0.07	−0.06	37.4	A
Protoptilum carpenteri	5538	3234	3712	6245	6946	0.07	−0.06	37.1	A
Umbellula huxleyi	5633	3232	3760	6302	6992	0.08	−0.06	36.9	A
Umbellula sp. 1	5479	3498	3572	6165	7070	0.01	−0.06	37.8	G (new)
Umbellula sp. 2	5592	3189	3705	6280	6894	0.07	−0.06	36.7	A
Umbellula sp. 3 _ 13k	3709	2295	2576	4358	4871	0.06	−0.08	37.6	Contig i
Umbellula sp. 3 _ 5k	1717	1004	1189	1669	2193	0.08	0.01	39.3	Contig ii
Virgularia mirabilis	5582	3195	3686	6307	6881	0.07	−0.06	36.7	A

Table 7. Presence of inverted repeats and A-T rich stem-loop as evidence for OriL.

Gene order	Species	Inverted repeats	A-T rich stem loop
B	Anthoptilum grandiflorum		x
B	Anthoptilum sp. 1		x
A	Distichoptilum gracile
A	Funiculina quadrangularis	x	x
A	Halipteris cf. finmarchica
A	Kophobelemnon sp. 1		x
A	Kophobelemnon sp. 3
A	Kophobelemnon sp. 4	x	x
A	Pennatula aculeata	x	x
A	Pennatula cf. aculeata	x	x
A	Pennatula cf. inflata	x	x
A	Pennatula grandis	x	x
A	Protoptilum carpenteri	x	x
A	Umbellula huxleyi
new - G	Umbellula sp. 1		x
A	Umbellula sp. 2	x
contig i	Umbellula sp. 3 _ 13k
contig ii	Umbellula sp. 3 _ 5k		N/A
A	Virgularia mirabilis	x	x

In gene order A, these are in the nad4-trnM region, for gene order B in the nad4l-nad4, and for gene order G, the nad4-mtMutS region.

Figure 2. DNA-Walk (Graph DNA) vectorial representation of linearized pennatulacean mitochondrial genomes into a 2 D trajectory along the genome. Every nucleotide direction is determined by the compass in the left corner, representing a cumulative skew (window size: 900). a: gene order A. b: gene order B. c: new gene order G. d: bipartite genome. Genes and IGRs are marked in the abrupt inversions in base composition bias, which can be an indicative of origin of replication (suggested IGRs marked in bold and underline). Sequences start at the middle of cox2 (*) and finish at the middle of cox2 (.), except for Umbellula sp. 3 (contig ii) which starts at mtMutS (*) and finishes at nad4L (.). Dashed line represents the overall DNA-Walk shape for gene order A.

Figure 3. Scenarios of the possible mechanism of the mitochondrial gene rearrangement using parsimony hypothesis in CREx. a. Transition from gene order A to gene order B. b. Transition from gene order A to gene order G. Small coloured rectangles correspond to the four octocoral conserved gene blocks (block 1: red; block 2: blue; block 3: yellow; block 4: green). Highlighted coloured rectangles mark the genes that have been reversed (light green), transposed (brown), and reverse transposed (dark green).

Park, E, Kim, B, Won, Y-J. 2010. The complete mitochondrialgenome of Dendronephthya gigantea (Anthozoa: Octocorallia: Nephtheidae). Korean J. Syst. Zool 26:197–201.

 Google Scholar

France, SC, Hoover, LL. 2002. DNA sequences of the mitochondrial COI gene have low levels of divergence among deep-sea octocorals (Cnidaria: Anthozoa). Hydrobiologia 471:149–155.

 Web of Science ®Google Scholar

Sánchez, JA, McFadden, CS, France, SC, Lasker, HR. 2003. Molecular phylogenetic analyses of shallow-water Caribbean octocorals. Marine Biology 142:975–987. 

 Web of Science ®Google Scholar

McFadden CS, France SC, Sánchez JA, Alderslade P. 2006. A molecular phylogenetic analysis of the Octocorallia (Cnidaria: Anthozoa) based on mitochondrial protein-coding sequences. Mol Phylogenet Evol. 41:513–527.

 PubMed Web of Science ®Google Scholar

Brugler MR, France SC. 2008. The mitochondrial genome of a deep-sea bamboo coral (Cnidaria, Anthozoa, Octocorallia, Isididae): genome structure and putative origins of replication are not conserved among octocorals. J Mol Evol. 67:125.

 PubMed Web of Science ®Google Scholar