Kidney cell culture of Rana dybowskii and study molecules of TRIF in Rana dybowskii cells under the stress of Aeromonas hydrophila

Figures & data

Table I. Primer information.

Primer name	Sequence	Purpose
M3’S	TGGGGGAAAGTGTATCACCACGCAT	3’-RACE PCR
MRT	5’-Phosphate-CAGATTATGGTCCG	3’-RACE PCR
M5’S	TCAAGCAAGTCGCCACCGTT	5’-RACE PCR
M5’A	CAGAAGTGAGTCGGTTGGAT	5’-RACE PCR
β-Actin-1	GCCATCTCATTCTCAAAGT	qPCR analysis
β-Actin-2	CCAAGCCATCATGCGTCT
RdTRIF-S	AGCAGACATTCACCATAG	qPCR and tissue distribution analysis
RdTRIF-A	CGTAAGCAGGGAGAGATT

Figure 1. Corresponding cell growth curve, the abscissa in the figure is the number of days of culture, and the ordinate is the total number of cells recorded by scientific notation.

Figure 2. Histogram of cell activity. In this figure, the abscissa represents the number of days of culture and the ordinate represents the percentage of living cells.

Figure 3. The photos taken during cell culture were taken before each cell bottle division. The pictures taken from a to h were taken at 1 day, 3 days, 5 days, 7 days, 9 days, 11 days, 13 days, and 15 days of cell culture, respectively.

Figure 4. Evolutionary tree analysis. The tree was constructed using the molecular phylogenetic analysis by maximum likelihood method based on gene sequence in MEGA 5.1.

Figure 5. Gene sequence of TRIF cDNA in Rana dybowskii. The number of nucleotide sequences is shown from left to right. The red letters designate the start codon. The blue double underline represents the TIR domain.

Figure 6. Protein sequence analysis and protein secondary structure prediction. The TRIF in Rana dybowskii (Rd), Danio rerio (dr), and Homo sapiens (hs). The alignment was performed by ClustalX and edited manually.

Figure 7. Phosphorylation sites.

Table II. Phosphorylation sites in RdTRIF.

Name	Position	Context*	Score**	Name	Position	Context*	Score**
Thr(T)	8	NHLNTDLDD	0.578	Ser(S)	19	HTLRSDLCS	0.575
	16	DAPHTLRSD	0.890		23	SDLCSQGIS	0.561
	67	SASATQTPC	0.574		27	SQGISIPRP	0.585
	69	SATQTPCTN	0.947		32	IPRPSHHSL	0.988
	95	SNLCTTNQE	0.603		35	PSHHSLSRI	0.958
	136	HSSQTFPDP	0.862		37	HHSLSRISN	0.897
	157	SLGVTIHKS	0.538		40	LSRISNALE	0.656
	223	VGKGTTFCE	0.597		46	ALEISQSPN	0.588
	224	GKGTTFCET	0.937		48	EISQSPNRA	0.671
	231	ETFETPGVN	0.781		60	EQRNSQGSA	0.990
	270	FQSATVMMN	0.720		63	NSQGSASAT	0.973
	318	RIFETKVRN	0.790		65	QGSASATQT	0.973
	323	KVRNTFKKD	0.961		105	YQQSSDHLC	0.548
	343	KVRTTSDFQ	0.563		120	EEEVSEDKN	0.657
	369	LSQQTQPQI	0.560		129	TDGHSYAHS	0.510
	380	FHGQTPVIQ	0.584		134	YAHSSQTFP	0.701
	343	KVRTTSDFQ	0.563		153	MHELSLGVT	0.505
	369	LSQQTQPQI	0.560		165	SNPFSEKES	0.997
Tyr (Y)	101	NQEKYQQSS	0.928		169	SEKESHLSN	0.743
	249	ENSAYIVLL	0.852		172	ESHLSNIFS	0.503
	417	DKNMYHDAG	0.956		177	NIFSSPDVL	0.622
					189	SVNSSDQFF	0.509
					208	QEIASRVCN	0.519
					247	AVENSAYIV	0.741
					275	VMMNSIENP	0.894
					284	HKLGSIIPF	0.680
					312	PLDESSRIF	0.609
					344	VRTTSDFQQ	0.981
					357	LLQCSMSDA	0.971
					359	QCSMSDASA	0.516
					366	SAVLSQQTQ	0.605
					404	NIQFSPNEP	0.982

* The sequence surrounding the predicted phosphorylation site.

** The likelihood of the residue being phosphorylated. (Not less than 0.500).

Figure 8. Evolutionary tree analysis. The tree was constructed with the neighbor-joining method in MEGA 5.1 based on amino acid sequences.

Figure 9. Expression of relative mRNA level of TRIF in the kidney. RdTRIF mRNA levels obtained from the Ah-exposed kidneys were detected by qRT-PCR. Each frog was given an intraperitoneal injection of 10⁷ CFU/frog Ah. At 2, 4, 8, 12, 24, 48, and 72 hpi, we isolated total RNAs, with β-Actin being the endogenous reference. Data were represented in the form of mean ±SD (bars) from 3 separate assays. (***p < 0.05; ****p < 0.01).

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article.