An integrative description of Mesobiotus mandalori sp. nov. (Eutardigrada, Macrobiotoidea) from Poland

Figures & data

Table I. Primers with their original references used for sequencing of three molecular markers of Mesobiotus mandalori sp. nov.

DNA molecular marker	Primer name and direction	Primer sequence (5’-3’)	Source
COI	LCO1490 (forward)	GGTCAACAAATCATAAAGATATTGG	Folmer et al. (1994)
	HCO2198 (reverse)	TAAACTTCAGGGTGACCAAAAAATCA
18S rRNA	SSU01_F	AACCTGGTTGATCCTGCCAGT	Sands et al. (2008)
	SSU82_R	TGATCCTTCTGCAGGTTCACCTAC
28S rRNA	28SF0001	ACCCvCynAATTTAAGCATAT	Mironov et al. (2012)
	28SR0990	CCTTGGTCCGTGTTTCAAGAC
ITS2	18S_Tar_Ff1	AGGCGAAACCGCGAATGGCTC	Stec et al. (2017)
	18S_Tar_Rr1	GCCGCAGGCTCCACTCCTGG

Table II. Linear regression of morphometric traits in relation to buccal tube length in Mesobiotus mandalori sp. nov. SSIPm represents Stylet support insertion point (µm), BTEWm represents Buccal Tube External width (µm), BTIWm represents Buccal Tube Internal Width (µm), VLLm represents Ventral Lamina Length (µm), M1m represents Macroplacoid 1 length (µm), M2m represents Macroplacoid 2 length (µm), M3m represents Macroplacoid 3 length (µm), Mim represents Microplacoid length (µm), MRm represents Macroplacoid Row length (µm) and PRm represents Placoid Row length (µm). The simple linear regression is performed using Graphpad Prisn 8.0.

CHARACTER	N	r^2	F	P value
SSIPm	21	0.9059	182.9	<0.0001
BTEWm	21	0.8252	89.71	<0.0001
BTIWm	21	0.7676	62.77	<0.0001
VLLm	21	0.8406	94.89	<0.0001
M1m	21	0.7098	46.48	<0.0001
M2m	21	0.8635	120.2	<0.0001
M3m	21	0.8105	81.27	<0.0001
Mim	21	0.7987	75.38	<0.0001
MRm	21	0.8239	88.9	<0.0001
PRm	21	0.8469	105.1	<0.0001

Table III. Linear regression of morphometric traits in relation to buccal tube length in Mesobiotus mandalori sp. nov. SSIPpt represents Stylet support insertion point (pt value), BTEWpt represents Buccal Tube External width (pt value), BTIWpt represents Buccal Tube Internal Width (pt value), VLLpt represents Ventral Laptina Length (pt value), PT1pt represents Macroplacoid 1 length (pt value), PT2pt represents Macroplacoid 2 length (pt value), PT3pt represents Macroplacoid 3 length (pt value), Mipt represents Microplacoid length (pt value), MRpt represents Macroplacoid Row length (pt value) and PRpt represents Placoid Row length (pt value). The simple linear regression is performed using Graphpad Prisn 8.0.

CHARACTER	N	r^2	F	P value
SSIPpt	21	7.555	0.2845	0.0128
BTEWpt	21	0.2177	0.01133	0.6461
BTIWpt	21	0.01672	0.0008794	0.8985
VLLpt	21	0.3035	0.01658	0.5885
M1pt	21	0.1363	0.007124	0.716
M2pt	21	0.6527	0.03321	0.4292
M3pt	21	0.0581	0.003048	0.8121
Mipt	21	3.205	0.1443	0.0894
MRpt	21	0.007542	0.0003968	0.9317
PRpt	21	0.0138	0.0007256	0.9077

Figure 1. X–Y plots of raw data for SSIP (a); BTEW (b), VLL (c) and BTIW (d).

Figure 2. X–Y plots of pt value BTEW (a), SSIP (b), BTIW (c) and VLL (d).

Table IV. Measurements [in µm] and pt values of selected morphological structures of Mesobiotus. mandalori sp. nov. Table contains measurements [in µm] and pt values of selected morphological structures of the newly described species. “N” stands for the number of specimens/structures measured; “RANGE” refers to measurements taken for the smallest and the largest structure among all measured specimens; SD stands for standard deviation.

CHARACTER		RANGE		MEAN		SD		Holotype		Thorpe’s Normalization
	N	µm	pt	µm	pt	µm	pt	µm	pt	b	a*	p_value
Body length	21	278–447	–	357	–	55	–	386	–	0,9947	358,7404	0,9925
Buccopharyngeal tube
Buccal tube length	21	29.9–47.8	–	38.9	–	5.6	–	39.4	–	1,0000	0,0000
Stylet support insertion point	21	23.3–36.9	74.8–78.6	29.8	76.6	4.2	1.0	30.3	77.0	0,9658	4,6069	0,9886
Buccal tube external width	21	3.5–6.8	11.8–14.7	5.3	13.5	1.0	0.9	5.0	12.6	1,3546	−2,4221	0,7992
Buccal tube internal width	21	2.5–5.4	8.4–11.5	4.0	10.1	0.8	0.8	3.4	8.7	1,3428	−1,3765	0,6841
Ventral lamina length	20	19.3–32.4	61.4–68.9	25.5	65.3	3.8	2.2	26.0	66.2	0,9835	−2,4483	0,9860
Placoid lenghs
Macroplacoid 1	21	3.4–7.9	11.2–16.7	5.6	14.2	1.3	1.7	5.3	13.4	1,4497	−4,6592	0,4781
Macroplacoid 2	21	2.6–5.8	8.7–13.0	4.3	11.0	0.9	1.1	4.3	10.8	1,4869	−1,3603	0,6098
Macroplacoid 3	21	3.2–7.6	10.6–16.1	5.1	12.8	1.3	1.6	4.6	11.7	1,7411	−4,6996	0,6482
Microplacoid	21	2.4–5.0	6.9–11.6	3.6	9.1	0.8	1.1	3.9	10.0	1,3559	1,0683	0,5253
Macroplacoid row	21	11.1–24.9	37.1–54.1	17.7	45.0	4.0	4.2	16.6	42.3	1,5169	−10,2607	0,6926
Placoid row	21	14.4–30.6	48.3–64.0	22.2	56.5	4.6	4.1	21.7	55.0	1,4102	−11,1145	0,7673
Claw 1 heights
External primary branch	17	6.1–10.7	19.5–25.4	8.3	21.4	1.2	1.4	8.7	22.0	0,9424	0,9770	0,9112
External secondary branch	17	4.3–8.1	12.4–19.5	6.2	15.9	1.1	1.7	5.8	14.8	0,9703	−0,3912	0,9256
Internal primary branch	14	6.3–8.7	17.5–23.4	7.6	20.1	0.9	1.9	7.7	19.5	0,6077	6,5867	0,0839
Internal secondary branch	13	4.5–7.3	12.6–17.5	5.6	14.8	0.9	1.5	5.6	14.1	0,8429	3,2847	0,6249
Claw 2 heights
External primary branch	20	6.3–11.3	20.6–27.7	9.0	23.0	1.3	2.0	10.1	25.5	0,8659	4,3996	0,6470
External secondary branch	19	4.7–8.8	10.4–20.6	6.3	16.2	1.1	2.3	7.7	19.4	0,6804	0,8490	0,0090
Internal primary branch	15	6.4–9.7	16.9–24.7	8.0	20.8	1.0	2.1	9.7	24.5	0,6525	15,0721	0,0790
Internal secondary branch	14	4.6–7.4	12.4–18.4	5.9	15.4	0.8	1.8	6.9	17.5	0,5758	8,7342	0,0071
Claw 3 heights
External primary branch	18	7.2–10.8	19.5–27.4	8.7	22.4	1.0	2.2	10.8	27.4	0,5941	5,4280	0,0091
External secondary branch	18	5.3–8.1	13.6–21.7	6.5	16.8	0.8	2.2	8.1	20.7	0,4631	6,2190	0,0000
Internal primary branch	15	5.9–9.1	18.2–23.4	8.0	20.6	0.9	1.6	9.1	23.2	0,6580	3,8842	0,2178
Internal secondary branch	14	4.0–8.0	12.2–17.1	6.0	15.1	1.0	1.4	6.6	16.6	0,9525	−1,9801	0,8963
Claw 4 lengths
Anterior primary branch	18	6.8–11.8	20.1–28.3	9.2	23.6	1.5	2.1	11.1	28.3	0,8899	1,8953	0,7418
Anterior secondary branch	18	5.4–8.7	15.5–20.5	6.9	17.7	1.1	1.5	6.3	16.1	0,8462	−5,4539	0,6318
Posterior primary branch	17	7.1–13.0	21.2–29.5	10.2	26.2	1.7	1.9	?	?	0,9865	2,2307	0,9783
Posterior secondary branch	17	4.1–9.2	13.2–21.4	6.6	16.8	1.4	2.5	?	?	1,0585	3,2332	0,8378

Figure 3. Mesobiotus mandalori sp. nov. — Phase-contrast microscope (PCM) and scanning electron microscope (SEM images of habitus morphology: (a) — PCM dorso-ventral projection (holotype); (b) — SEM dorsal projection (paratype). Scale bars in μm.

Figure 4. Mesobiotus mandalori sp. nov. —PCM images of claws I, III and IV: (a) — Claw I with smooth lunules (paratype); (b) —Claw III with smooth lunules (paratype); (c) — Claw IV with dented lunules (holotype). (d) — Lunules under claws IV with dented lunules (paratype). Filled flat arrowhead indicates lunules; filled indented arrowheads indicate the granulation; empty indented arrowheads indicate the indicates horseshoe structure connecting the anterior and the posterior claws; empty arrow indicates a single continuous cuticular bar under the claws; filled arrow indicates paired muscle attachments Scale bars in μm.

Figure 5. Mesobiotus mandalori sp. nov. —PCM images of the entire buccal apparatus: (a) — dorsal view of entire buccal apparatus (holotype); (b) — ventral view of entire buccal apparatus (holotype). Scale bars in μm.

Figure 6. Mesobiotus mandalori sp. nov. —PCM images of oral cavity armature (OCA) and placoid morphology: (a) — dorsal view of OCA (paratype); (b) — ventral view of OCA (paratype); (c) — dorsal view of placoid morphology; (d) — ventral view of placoid morphology. Filled flat arrowheads indicate peribuccal lamellae; empty flat arrowheads indicate the first band of teeth; filled indented arrowheads indicate the second band of teeth; filled indented arrowheads indicate the third band of teeth, filled arrows indicate the middle ridge dorsal and ventral respectively; empty arrows indicate subterminal constrictions in the third macroplacoid. Scale bars in μm.

Table V. Measurements [in µm] of selected morphological structures of eggs of Mesobiotus mandalori sp. nov. Table contains measurements [in µm] structures of eggs of newly described species. Where “N” stands for the number of specimens/structures measured; “RANGE” refers to measurements taken for the smallest and the largest structure among all measured specimens; SD stands for standard deviation.

CHARACTER	N	RANGE	MEAN	SD
Egg bare diameter	20	53.7–77.7	66.4	6.1
Egg full diameter	20	70.2–101.3	87.9	6.8
Process height	60	9.8–16.3	12.4	1.5
Process base width	60	12.6–19.0	16.2	1.4
Process base/height ratio	60	106%–160%	132%	15%
Inter-process distance	75	1.6–6.3	3.0	0.9
Number of processes on the egg circumference	20	10–12	11.1	0.7
Egg bare diameter	20	53.7–77.7	66.4	6.1

Figure 7. Mesobiotus mandalori sp. nov. —PCM and SEM images of the eggs, egg surface, egg processes surface and midsections: (a) PCM image of the eggs; (b) SEM image of the egg; (c) PCM image of the egg surface; (d) SEM image of the egg surface; (e-f) SEM images of the egg processes surface; (g-j) PCM images of the egg processes midsections. Filled flat arrowhead indicates reticular design; filled indented arrowheads indicate crowns of strong thickenings around the process base; empty indented arrowheads indicate pores;filled arrow indicates bubble-like internal structures, Filled flat arrowheads indicate reticular design; filled arrows crowns of strong thickenings around the process base; empty arrows indicate pores. Scale bars in μm.

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5):294–299. Table 1.

 PubMedGoogle Scholar

Sands CJ, SJ M, Marley NJ, Goodall-Copestake WP, Convey P, Linse K. 2008. Phylum Tardigrada: An “individual” approach. Cladistics 24(6):861–871. DOI: 10.1111/j.1096-0031.2008.00219.x. Table 1.

 PubMed Web of Science ®Google Scholar

Mironov SV, Dabert J, Dabert M. 2012. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the long-tailed tit Aegithalos caudatus (Passeriformes: Aegithalidae)—morphological description with DNA barcode data. Zootaxa 3253(1):54–61 DOI: 10.11646/zootaxa.3253.1.2. Table 1.

 Google Scholar

Stec D, Zawierucha K, Michalczyk Ł. 2017. An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300(3):403–420. DOI: 10.11646/zootaxa.4300.3.4.

 Web of Science ®Google Scholar