Effects of oxidation defense system exposure to Benzo(a)pyrene on CYP450 gene expression and EROD activity in Crassostrea gigas and Mytilus coruscus

Figures & data

Table 1. Name and sequence of the target gene amplified with primers

Genes		Primer sequences(5ʹ-3ʹ)	Product size/bp
Actin	F	GTCACAAACTGGGATGATATGGAG	119
	R	TTGGCTTTAGGGTTGAGTGGA
CYP450	F	GCCTGCCTTTGTTGTCTTCAC	80
	R	CAGCCCACCTCTGACCTACTCT

Table 2. The concentration of BAP in different tissues of Crassostrea gigas and Mytilus coruscus.

BAP (μg/L)	Time	Crassostrea gigas			Mytilus coruscus
		liver(ng/g)	gill(ng/g)	mantle(ng/g)		liver(ng/g)	gill(ng/g)	mantle(ng/g)
5	1d	18.68 ± 5.64	13.78 ± 2.55	30.25 ± 1.43		16.38 ± 1.28	14.18 ± 2.73	30.35 ± 1.44
	3d	23.67 ± 6.79	16.24 ± 4.22	32.18 ± 2.39		21.01 ± 5.06	17.93 ± 3.99	33.24 ± 2.71
	9d	29.52 ± 7.87	20.36 ± 5.63	35.75 ± 3.26		27.77 ± 4.69	20.62 ± 4.06	36.28 ± 3.02
	15d	35.24 ± 8.26	22.44 ± 6.29	38.21 ± 4.77		33.25 ± 5.07	24.56 ± 4.35	39.37 ± 3.75
1	1d	15.04 ± 2.43	8.46 ± 1.35	26.14 ± 1.39		9.46 ± 2.08	9.86 ± 1.39	27.20 ± 1.25
	3d	20.33 ± 2.96	10.81 ± 3.22	28.99 ± 1.65		14.53 ± 3.89	10.45 ± 3.51	29.03 ± 1.56
	9d	25.56 ± 4.88	13.26 ± 3.86	31.73 ± 3.84		20.10 ± 4.75	12.53 ± 5.19	21.19 ± 2.96
	15d	29.71 ± 5.35	16.76 ± 4.34	34.11 ± 3.27		25.62 ± 5.86	14.01 ± 4.62	23.47 ± 3.19
0.2	1d	3.49 ± 1.06	2.19 ± 0.31	11.06 ± 0.29		4.22 ± 1.01a	2.41 ± 0.63	11.99 ± 1.05
	3d	7.04 ± 1.13	3.23 ± 0.47	12.32 ± 0.34		7.97 ± 1.24	4.89 ± 0.92	13.33 ± 1.08
	9d	11.28 ± 1.26	4.36 ± 0.52	14.16 ± 0.68		10.56 ± 1.22	6.25 ± 1.05	15.75 ± 1.13
	15d	15.55 ± 1.43	5.88 ± 0.76	15.23 ± 1.06		13.18 ± 2.43	7.48 ± 1.69	16.89 ± 1.27
Control	1d	0.48 ± 0.24	0.51 ± 0.25	0.42 ± 0.13		0.45 ± 0.03	0.46 ± 0.05	0.39 ± 0.15
	3d	0.46 ± 0.36	0.49 ± 0.17	0.43 ± 0.09		0.43 ± 0.07	0.50 ± 0.06	0.41 ± 0.17
	9d	0.47 ± 0.27	0.51 ± 0.18	0.44 ± 0.15		0.45 ± 0.09	0.45 ± 0.09	0.42 ± 0.08
	15d	0.48 ± 0.29	0.52 ± 0.23	0.43 ± 0.08		0.44 ± 0.08	0.48 ± 0.04	0.41 ± 0.09

Figure 1. The effects of BaP on the CYP450 relative gene expression level of Crassostrea gigas.

The significance levels observed are *p < 0.05 in comparison to control group values.

Figure 2. The effects of BaP on the CYP450 relative gene expression level of Mytilus coruscus.

The significance levels observed are *p < 0.05 in comparison to control group values.

Figure 3. The effects of BaP on the EROD activity of Crassostrea gigas.

The significance levels observed are *p < 0.05 in comparison to control group values.

Figure 4. The effects of BaP on the EROD activity of Mytilus coruscus.

The significance levels observed are *p < 0.05 in comparison to control group values.

Table 3. Linear regressions of EROD activity and CYP450 as function of BaP uptake; and CYP450 gene expression as function of EROD activity

Item	Tissues	Crassostrea gigas	Mytilus coruscus
EROD-BaP uptake	Liver	Y = 0.037X+1.125 R^2 = 0.958	Y = 0.573X+2.455 R^2 = 0.962
	Gill	Y = 0.029X+1.083 R^2 = 0.917	Y = 0.491x+3.082 R^2 = 0.902
	Mantle	Y = 0.513X+0.806 R^2 = 0.898	Y = 0.459x+2.417 R^2 = 0.835
CYP450-BaP uptake	Liver	Y = 0.459x + 3.706 R^2 = 0.927	Y = 0.558x + 2.734 R^2 = 0.940
	Gill	Y = 0.512x + 3.531 R^2 = 0.913	Y = 0.491x + 3.082 R^2 = 0. 899
	Mantle	Y = 0.515x + 2.887 R^2 = 0.864	Y = 0.464x + 2.356 R^2 = 0.875
EROD- CYP450	Liver	Y = 0.085x + 0.819 R^2 = 0.945	Y = 0.112x + 0.793 R^2 = 0.917
	Gill	Y = 0.052x + 0.866 R^2 = 0.923	Y = 0.087x + 0.792 R^2 = 0.906
	Mantle	Y = 0.042x + 0.576 R^2 = 0.897	Y = 0.057x + 0.600 R^2 = 0.892