Deficiency of CD3gamma, delta, epsilon, and zeta expression in T cells from AML patients

Figures & data

Table 1. Clinical data of AML patients

No.	Gender	Age (years)	Diagnosis	WBC count (109/l)	RBC count (1012/l)	PLT count (109/l)	Blast cells (%)
1	M	65	M1	164	2·62	41	97
2	M	21	M1	125·9	5·07	40	91
3	M	23	M2	56·48	3·69	22	79
4	F	53	M2	29·96	2·64	11	88
5	F	35	M2	234·1	2·11	29	89
6	F	13	M3	24·89	2·5	45	91
7	M	37	M4	10·95	3·78	27	57
8	M	27	M4	109·5	2·39	148	86
9	M	39	M4	61·87	2·64	34	75
10	M	49	M5	83·37	1·49	48	79

Table 2. Sequences of primers used in PCR

Primer	Sequence	Accession no.	PCR products (bp)
CD3gamma‐f	5′‐GGGATGTATCAGTGTAAAGG‐3′	NM_000073	166
CD3gamma‐b	5′‐CAGCAATGAAGTAGACCC‐3′
CD3delta‐f	5′‐TCATTGCCACTCTGCTCC‐3′	NM_000732	184
CD3delta‐b	5′‐GTTCACTTGTTCCGAGCC‐3′
CD3epsilon‐f	5′‐TCCCAACCCAGACTATGAGC‐3′	NM_000733	158
CD3epsilon‐b	5′‐CAAGACTAGCCCAGGAAACAG‐3′
CD3zeta‐f	5′‐GCCAGAACCAGCTCTATAAC‐3′	J04132	166
CD3zeta‐b	5′‐TAGGCCTCCGCC ATCTTATC‐3′
Beta2M‐f	5′‐TACACTGAATTCACCCCCAC‐3′	J00105	144
Beta2M‐b	5′‐CATCCAATCCAAATGCGGCA‐3′

Figure 1. The relative expression of CD3 genes in CD3⁺ T cells from AML and healthy (HI) groups.

Figure 2. The pattern of CD3 gene expression levels in CD3⁺ T cells from 10 cases with AML and healthy individuals (HI).

Figure 3. The correlation analysis among the relative expression levels of CD3gamma, delta, epsilon, and zeta chain genes in CD3⁺ T cells from AML patients.

Call ME, Wucherpfenning KW. The T cell receptor: critical role of the membrane environment in receptor assembly and function. Annu Rev Immunol 2005;23:101–25.

 PubMed Web of Science ®Google Scholar

Arnett KL, Harrison SC, Wiley DC. Crystal structure of a human CD3-epsilon/delta dimmer in complex with a UCHT1 single­chain antibody fragment. Proc Natl Acad Sci USA 2004;101:16268–73.

 PubMed Web of Science ®Google Scholar