Nrf2-mediated antioxidant response by ethanolic extract of Sida cordifolia provides protection against alcohol-induced oxidative stress in liver by upregulation of glutathione metabolism

Figures & data

Table 1. Primer sequences used for RT-PCR analysis

Genes	Primer sequences	Gene accession number
GAPDH	Forward 5′ TGA CAA CTC CCT CAA GAT TGT CA 3′	NM 017008.4
	Reverse 5′ GGC ATG GAC TGT GGT CAT GA 3′
γGCS	Forward5′CCTTCTGGCACAGCACGTTG 3′	J 05181.1
	Reverse 5′TAAGACGGCATCTCGCTCCT3′

Table 2. Activities of toxicity marker enzymes

Groups	ALT (µmol pyruvate liberated/min/mg protein)		AST (µmol oxaloacetate liberated/min/mg protein		GGT (µmol p-nitroaniline liberated/min/mg protein) Serum
	Liver	Serum	Liver	Serum
Control	15.51 ± 1.49^a	51.68 ± 4.96^a	19.78 ± 1.90^a	185.27 ± 17.80^a	17.43 ± 1.59^a
Alcohol	48.81 ± 4.68^b	107.25 ± 10.29^b	78.52 ± 7.53^b	351.20 ± 33.69^b	62.40 ± 5.99^b
SAE	15.62 ± 1.50^a	52.66 ± 5.06^a	20.76 ± 1.99^a	187.62 ± 18.00^a	17.65 ± 1.69^a
Alcohol + SAE	20.29 ± 1.95^c	57.46 ± 5.38^a	27.77 ± 2.79^c	195.08 ± 18.71^a	28.76 ± 2.13^c

Values are mean ± SD. Values not sharing a common superscript differ significantly at P < 0.05.

Table 3. Activity of alcohol dehydrogenase and ROS levels in liver

Groups	Alcohol dehydrogenase (µmol of NAD^+ reduced/min/mg protein	ROS (pmol DCF/mg protein)
Control	0.21 ± 0.02^a	14.3 ± 1.3^a
Alcohol	1.54 ± 0.14^b	37.4 ± 3.6^b
SAE	0.19 ± 0.02^a	12.9 ± 1.3^a
Alcohol + SAE	0.72 ± 0.07^c	19.5 ± 2.0^c

Values are mean ± SD. Values not sharing a common superscript differ significantly at P < 0.05.

Table 4. Activities of glutathione peroxidase (GPx), glutathione reductase (GR), and glutathione-S-transferase (GST)

Groups	GPx (µmol NADPH oxidized/min/mg protein)	GR (µmol NADPH oxidized/min/mg protein)	GST (nmol conjugate formed/min/mg protein)	GSH (mg/100 g tissue)
Control	13.37 ± 1.28^a	20.75 ± 1.99^a	0.08 ± 0.007^a	518.76 ± 49.87^a
Alcohol	6.04 ± 0.58^b	5.16 ± 0.49^b	0.16 ± 0.019^b	392.12 ± 37.61^b
SAE	13.70 ± 1.34^a	21.62 ± 2.07^c	0.08 ± 0.007^a	527.37 ± 50.59^a
Alcohol + SAE	12.39 ± 1.13^a	18.65 ± 1.79^c	0.20 ± 0.024^c	513.89 ± 49.30^a

Values are mean ± SD. Values not sharing a common superscript differ significantly at P < 0.05.

Table 5. Level of lipid peroxidation products

Groups	MDA (mmol/100 g wet tissue)	HP (mmol/100 g wet tissue)	CD (mmol/100 g wet tissue)
Control	0.50 ± 0.05^a	8.98 ± 0.86^a	60.63 ± 5.82^a
Alcohol	0.99 ± 0.10^b	18.61 ± 1.79^b	146.47 ± 14.05^b
SAE	0.48 ± 0.04^a	8.77 ± 0.84^a	53.63 ± 5.15^a
Alcohol+SAE	0.57 ± 0.52^c	9.97 ± 0.96^c	73.79 ± 7.08^c

Values are mean ± SD. Values not sharing a common superscript differ significantly at P < 0.05.

Figure 1. ELISA of nuclear translocation of Nrf2

Figure 2. Intensity of γGCS mRNA using gel doc. The relative amount of γGCS mRNA was estimated by semi-quantitative RT-PCR. The PCR products were quantified by densitometry and standardized to their respective GAPDH controls. The mean intensity was measured and expressed as intensity/mm². Results are expressed as average of quadriplicate experiments ± SD. Different letters indicate values statistically significant at P < 0.05. The level of γGCS mRNA was decreased significantly in alcohol-treated rats compared to control rats and there was an increase in the level in co-administered group compared to alcohol-treated group.