Allelic polymorphisms of human platelets-specific alloantigens in South Tunisian population

Figures & data

Table 1. Sequences and length of designed primers for HPA-1, -3, -5 and the two internal positive control primers

Primer code	Primer sequences	Length primers	PCR products length (bp)
HPA-1a-I	ACTTACAGGCCCTGCCTCT	19	189
HPA-1b-I	ACTTACAGGCCCTGCCTCC	19
HPA-1-II (common)	GTGCAATCCTCTGGGGACT	19
HPA-3a-I	GGGGGAGGGGCTGGGGA	17	293
HPA-3b-I	GGGGGAGGGGCTGGGGC	17
HPA-3-II (common)	GGCCCTGGGACTGTGAATG	19
HPA-5a-I	AGGAAGAGTCTACCTGTTTACTATCAAAG	29	256
HPA-5b-I	AGGAAGAGTCTACCTGTTTACTATCAAAA	29
HPA-5-II (common)	CTCTCATGGAAAATGGCAGTA	21
CRP-I	CCAGCCTCTCTCATGCTTTTGGCCAGACAG	30	440
CRP-II	GGGTCGAGGACAGTTCCGTGTAGAAGTGGA	30

I: forward primer; II: reverse primer

Figure 1. Examples of amplification in HPA-1a system. The upper band corresponds to the amplification product of the CRP gene (internal control of 440 bp). The lower band corresponds to the amplification product of HPA-1a gene (189 bp) situated between 123 and 246 bp bands of molecular weight markers.Lane1: negative control; lanes 2, 3, 4, 6, and 7: individuals with HPA-1a allele; lane 5: individual without HPA-1a allele; lane 8: molecular weight marker of 123 bp.

Table 2. Genotype frequencies of HPA-1, -3, and -5

Genotypes	HPA-1	HPA-3	HPA-5
a/a	0.670	0.430	0.750
a/b	0.288	0.462	0.241
b/b	0.042	0.108	0.009

Table 3. Frequencies of HPA alleles in different ethnic groups

Country	Ethnic groups	Effective	HPA-1a	HPA-1b	HPA-3a	HPA-3b	HPA-5a	HPA-5b	Method
Chine^Citation16	Chinese	1000	0.994*	0.006^†	0.5945	0.4055	0.9860*	0.014^†	PCR-SSP
Japon^Citation30	Blood donors Japanese	331	0.991*	0.009^†	0.718	0.282	0.973*	0.027^†
Brazil^Citation20	Caucasian	100	0.925*	0.075^†	0.600	0.400	0.920	0.080	PCR-RFLP
Pakistan^Citation19	Major ethnic groups and castes of Pakistani population (Pathans and Sindhis)	593	0.885*	0.115^†	0.69	0.31	0.9	0.1	PCR-SSP
Austria^Citation21	Caucasoid of mixed background	911–906–931	0.852	0.148	0.612	0.388	0.892	0.108	PCR-RFLP
France^Citation22	Caucasian random platelet donors	6192	0.848	0.152	0.62	0.38	0.874	0.126	PCR SSP
Germany^Citation18	Random blood donor, estimated 99% Caucasian	1583–1562–1643	0.84	0.16	0.60	0.40	0.92*	0.08^†	PCR SSP
Germany^Citation7	Caucasians from Northen Germany	573	0.839	0.161	0.586	0.414	0.917*	0.083^†	PCR SSP
Croatia^Citation18	Caucasiens	430	0.83	0.17	0.64	0.36	0.89	0.11	PCR-SSP
Algeria^Citation21	–		0.827	0.173	–	–	0.837	0.163
Spain^Citation18	Spanish	727–662–454	0.81	0.19	0.65	0.35	0.88	0.12
Marocco^Citation15	Berber	107–104–112	0.748	0.252	0.682	0.318	0.861	0.139	PCR-SSP
Tunisia	Blood donors (Sfax)	212	0.814	0.186	0.660	0.340	0.870	0.130	PCR-SSP
Tunisia^Citation23	Blood donors (Tunis)	78–90–93	0.75	0.25	0.694	0.306	0.779^†	0.221*	PCR-RFLP
Tunisia^Citation26,Citation27	Blood donors (Tunis)	100	0.73	0.27	0.765	0.235	0.665^†	0.335*	PCR-SSP
Tunisia^Citation24	Central Tunisia (Monastir)	316	0.665^†	0.335*					PCR-SSP
Tunisia^Citation25	Sousse	444	0.59^†	0.41*	0.75*	0.25^†			PCR-SSP

RFLP, restriction-fragment-length polymorphism

*Frequency significantly higher than Southern Tunisia.

^†Frequency significantly lower than Southern Tunisia.

Feng ML, Liu DZ, Shen W, Wang JL, Guo ZH, Zhang X, et al. Etablissement of an HPA-1-to-16-typed platelet donor registry in China. Transfus. Med. 2006;16:369–374.

 PubMed Web of Science ®Google Scholar

Tanaka S, Ohnoki S, Shibata H, Okubo Y, Yamaguchi H, Shibata Y. Genes frequencies of human platelet antigens on glycoprotein IIIa in Japanese. Transfusion 1996;36:813–7.

 PubMed Web of Science ®Google Scholar

Castro V, Origa AF, Annichino-Bizzacchi JM, Soares M, Menezes RC, Gonçalves MS, et al. Frequencies of platelet-specific allontigens system 1–5 in three distinct ethnic groups in Brasil. Eur J Immunogenet. 1999;26:355–360.

 PubMedGoogle Scholar

Bhatti FA, Uddin M, Ahmed A, Bugert P. Human platelet antigen polymorphisms (HPA-1, -2, -3, -4, -5 and -15) in major ethnic groups of Pakistan. Transfus Med. 2009;20:78–87.

 PubMed Web of Science ®Google Scholar

Mercier P, Chicheportiche C, Dabonian C, Gamerre M, Reviron D. Platelet antigen HPA-5b (Bra) in the Algerian population. Tissue Antigens 1994;43:58–9.

 PubMed Web of Science ®Google Scholar

Mérieux Y, Dehost M, Bernaud J, Raffin A, Meyer F, Rigal D. Human platelet antigens frequencies of platelet donors in the French population deteminated by polymerase chain reaction with sequence specific primers. Pathol Biol. 1997;45:697–700.

 PubMed Web of Science ®Google Scholar

http://www.ebi.ac.uk/inc/foot.html.

 Google Scholar

Klüter H, Fehlau K, Panzer S, Kirchner H, Bein G. Rapid typing for human platelet antigen systems-1-2-3 and -5 by PCR amplification with sequence-specific primers. Vox Sang. 1996;71:121–5.

 PubMed Web of Science ®Google Scholar

Ferrer G, Muñiz-Diaz E, Aluja MP, Arilla M, Martinez C, Nogués R, et al. Analysis of human platelet antigen systems in a Moroccan Berber population. Transfus Med. 2002;12:49–54.

 PubMed Web of Science ®Google Scholar

Mojaat N, Halle L, Proulle V, Hmida S, Ben Hamed L, Boukef K, et al. Gene frequencies of human platelet antigens in the Tunisian population. Tissue Antigens 1999;54:201–204.

 PubMed Web of Science ®Google Scholar

Gorgi Y, Sfar I, Ben Abdallah T, Aouadi H, Abderrahim E, Bardi R, et al. Human Platelet Antigens: HPA-1, -2, -3, -4, and -5 Polymorphisms in Kidney Transplantation. Transplant Proc. 2007;39:2568–70.

 PubMed Web of Science ®Google Scholar

Gorgi Y, Sfar I, Ben Aabdallah T, Aouadi H, Abderrahim E, Bardi R, et al. Human platelet antigens polymorphisms and susceptibility of thrombosis in hemodialysis patients. Hemodial Int. 2008;12:331–5. 58.

 PubMed Web of Science ®Google Scholar

Abboud N, Amin H, Ghazouani L, Ben Haj Khalifa S, Ben Khalafallah A, Aded F, et al. Polymorphisms of human platelet alloantigens HPA-1 and HPA-2 associated with severe coronary artery disease. Cardiovasc Pathol. 2010;19(5):302–307.

 PubMed Web of Science ®Google Scholar

Saidi S, Mahjoub T, Slamia LB, Ammou SB, Al-Subaie AM, Almawi WY. Polymorphisms of the human platelet alloantigens HPA-1, HPA-2, HPA-3, and HPA-4 in ischemic stroke. Am J Hematol. 2008;83:570–573.

 PubMed Web of Science ®Google Scholar