Identifying the Potential Therapeutic Targets for Atopic Dermatitis Through the Immune Infiltration Analysis and Construction of a ceRNA Network

Figures & data

Table 1 Details of the GEO AD Data

Dataset	Platform	Number of Samples (AD/Control, Subjects)
GSE63741	GPL19471 PIQOR (TM) Skin 2.0 Microarray, human, antisense (591)	150(30/30,60)
GSE124700	GPL10558 Illumina HumanHT-12 V4.0 expression beadchip	4(2/2,6)

Abbreviation: AD, atopic dermatitis.

Table 2 The Primer Used in RT-qPCR

Gene	Primer Sequence (5ʹ – 3ʹ)
H-actin	F:ACCCTGAAGTACCCCATCGAG
	R:AGCACAGCCTGGATAGCAAC
H-NEAT1	F:CCTGCCTTCTTGTGCGTTT
	R:TAGCACAACACAATGACACCCT
H-XIST	F: ACTGCCACCCATATATAAGCTA
	R:AGTAATCACCATTCAGTAAGCCA

Table 3 The DEGs of AD

Regulation	Common DEGs of GSE63741 and GSE124700
Upregulated(n=14)	CCL18, CCL22, AKR1B10, CCL19, S100A7, LCE3D, IFI27
	CHI3L2, AQP3, LY6D, S100A8, RAB31, MMP12, S100A9
Downregulated(n=8)	FLG2, CST6, SERPINA12, HBB, KRT15, CCND1, LCE1B, HBA1

Abbreviations: AD, atopic dermatitis; DEGs, differentially expressed genes.

Figure 1 Data after normalization. (A) Standardization of selected samples of GSE63741. (B) Standardization of GSE124700. Green bars represent AD, blue bars represent control.

Abbreviation: AD, atopic dermatitis.

Figure 2 Identification of DEGs in AD. (A) The differentially expressed genes of GSE63741. (B) The differentially expressed genes of GSE124700. (C) 8 DEGs were consistently downregulated in the two datasets. (D) 14 DEGs were consistently upregulated in the two datasets. The green point represents downregulated genes, the red point represents upregulated. |log FC|>1 and p-value <0.05 were set as the difference.

Abbreviation: FC, fold change.

Figure 3 The heat map of the DEGs. The color from green to red indicates the expression of genes from low to high.

Abbreviation: AD, atopic dermatitis.

Table 4 The Top 10 Function and Pathway Enrichment Items of the DEGs

Category	Description	P value	Genes
GO BP	GO:0008544 epidermis development	5.45551E-08	AQP3,CST6,KRT15,S100A7,LCE3D,LCE1B,FLG2
GO BP	GO:0071621 granulocyte chemotaxis	5.44051E-10	S100A7,S100A8,S100A9,CCL18,CCL19,CCL22
GO BP	GO:0097530 granulocyte migration	1.54858E-09	S100A7,S100A8,S100A9,CCL18,CCL19,CCL22
GO BP	GO:0097529 myeloid leukocyte migration	1.64556E-08	S100A7,S100A8,S100A9,CCL18,CCL19,CCL22
GO BP	GO:0030595 leukocyte chemotaxis	2.08055E-08	S100A7,S100A8,S100A9,CCL18,CCL19,CCL22
GO BP	GO:0060326 cell chemotaxis	1.17284E-07	S100A7,S100A8,S100A9,CCL18,CCL19,CCL22
GO BP	GO:0030593 neutrophil chemotaxis	1.53171E-08	S100A8,S100A9,CCL18,CCL19,CCL22
GO BP	GO:1990266 neutrophil migration	3.74245E-08	S100A8,S100A9,CCL18,CCL19,CCL22
GO BP	GO:0048247 lymphocyte chemotaxis	1.87602E-07	S100A7,CCL18,CCL19,CCL22
GO BP	GO:0002548 monocyte chemotaxis	2.25311E-07	S100A7,CCL18,CCL19,CCL22
GO CC	GO:0060205 cytoplasmic vesicle lumen	5.6214E-06	HBA1,HBB,S100A7,S100A8,S100A9
GO CC	GO:0031983 vesicle lumen	5.7024E-06	HBA1,HBB,S100A7,S100A8,S100A9
GO CC	GO:0031012 extracellular matrix	0.000923351	MMP12,S100A7,S100A8,S100A9
GO CC	GO:0034774 secretory granule lumen	0.001974261	S100A7,S100A8,S100A9
GO CC	GO:0062023 collagen-containing extracellular matrix	0.004403432	S100A7,S100A8,S100A9
GO CC	GO:0030139 endocytic vesicle	0.001821123	HBA1,HBB,RAB31
GO MF	GO:0005509 calcium ion binding	0.000192896	MMP12,S100A7,S100A8,S100A9,FLG2
GO MF	GO:0043177 organic acid binding	3.1967E-05	HBA1,HBB,S100A8,S100A9
GO MF	GO:0050786 RAGE receptor binding	6.92211E-08	S100A7,S100A8,S100A9
GO MF	GO:0048020 CCR chemokine receptor binding	6.67899E-06	CCL18,CCL19,CCL22
GO MF	GO:0008009 chemokine activity	7.58116E-06	CCL18,CCL19,CCL22
GO MF	GO:0042379 chemokine receptor binding	2.22851E-05	CCL18,CCL19,CCL22
GO MF	GO:0048306 calcium-dependent protein binding	3.99042E-05	S100A7,S100A8,S100A9
GO MF	GO:0016209 antioxidant activity	4.13255E-05	HBA1,HBB,S100A9
GO MF	GO:0005125 cytokine activity	0.000799355	CCL18,CCL19,CCL22
GO MF	GO:0005126 cytokine receptor binding	0.001205692	CCL18,CCL19,CCL22
KEGG pathway	hsa04657 IL-17 signaling pathway	5.56373E-05	S100A7,S100A8,S100A9
KEGG pathway	hsa04062 Chemokine signaling pathway	0.000515188	CCL18,CCL19,CCL22
KEGG pathway	hsa04060 Cytokine-cytokine receptor interaction	0.002080696	CCL18,CCL19,CCL22

Abbreviations: DEGs, differentially expressed genes; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; BP, biological processes; CC, cellular components; MF, molecular functions.

Figure 4 The GSEA analysis of the DEGs. (A) Biological processes, cellular components and molecular functions. (B) The signaling pathways.

Figure 5 The top 10 items of GO and KEGG enrichment analysis of DEGs. (A) GO Biological processes. (B) GO cellular components. (C) GO molecular functions. (D) KEGG signaling pathways. **p<0.01; ***p<0.001.

Abbreviations: GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Table 5 The Top 5 Hub Genes

Genes	Description	Degree	MCC	Expression Change
HBB	Hemoglobin subunit beta	4	4	Downregulated
LCE3D	Late cornified envelope 3D	3	3	Upregulated
S100A7	S100 calcium binding protein A7	4	4	Upregulated
S100A9	S100 calcium binding protein A9	3	4	Upregulated
S100A8	S100 calcium binding protein A8	3	4	Upregulated

Abbreviation: MCC, maximal clique centrality.

Figure 6 The PPI network analysis and identification of hub genes. (A) PPI network of the DEGs. The sizes of the edges and nodes represent the degree, which is the bigger size representing the higher degree. The green node represents downregulated gene and the red represents upregulated. (B) The first module of the PPI network. The green node represents downregulated gene and the red represents upregulated. (C) 5 hub genes were identified through the cytoHubba plug-in. (D) The biological process of hub genes through ClueGO plug-in. (E) Signaling pathways of hub genes through ClueGO plug-in.

Table 6 Results of AUCs for Hub Genes

Hub Genes	AUC	95% Confidence Interval	P value
LCE3D	0.9342	0.8710 to 0.9974	<0.0001
S100A8	0.9328	0.8717 to 0.9938	<0.0001
S100A9	0.9246	0.8586 to 0.9905	<0.0001
S100A7	0.9122	0.8383 to 0.9861	<0.0001
HBB	0.7956	0.6720 to 0.9193	0.0002

Abbreviation: AUC, area under the curve.

Figure 7 Data verification of hub genes through GSE121212. (A) Gene expression of each hub gene. (B) The ROC curve of each hub gene. **p<0.01; ****p<0.0001.

Abbreviation: AD, atopic dermatitis.

Figure 8 The difference of immune infiltration between AD and controls. (A) PCA performed on all samples. (B) The proportion of immune cells in AD and controls. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; blue represents control and red represents AD.

Abbreviation: AD, atopic dermatitis.

Figure 9 The correlation between hub genes and immune cells. (A) HBB. (B) LCE3D. (C) S100A7. (D) S100A8. (E) S100A9. P< 0.05 was considered as statistical significance.

Table 7 The miRNAs Targeting Hub Genes

Genes	The miRNAs
HBB	hsa-miR-6851-3p hsa-miR-3922-5p hsa-miR-361-3p hsa-miR-1910-3p
	hsa-miR-6511a-5p hsa-miR-3914 hsa-miR-33a-3p hsa-miR-5009-5p
	hsa-miR-6822-5p hsa-miR-4307 hsa-miR-4423-3p hsa-miR-6750-5p
	hsa-miR-6886-3p hsa-miR-8058
LCE3D	hsa-miR-193b-5p hsa-miR-1224-5p hsa-miR-3170 hsa-miR-4700-5p
	hsa-miR-4320 hsa-miR-6763-5p hsa-miR-4667-5p hsa-miR-3690
	hsa-miR-4471 hsa-miR-513a-5p hsa-miR-4269 hsa-miR-4314
	hsa-miR-6750-5p hsa-miR-6855-5p hsa-miR-4691-5p hsa-miR-6792-3p
	hsa-miR-5004-5p
S100A7	hsa-miR-30c-2-3p hsa-miR-1343-3p hsa-miR-6788-5p hsa-miR-6852-5p
S100A8	hsa-miR-98-5p
S100A9	hsa-miR-4701-5p hsa-miR-132-5p hsa-miR-588 hsa-miR-1204
	hsa-miR-3677-5p hsa-miR-940 hsa-miR-6878-3p
	hsa-miR-766-5p hsa-miR-92a-1-5p hsa-miR-660-3p

Table 8 The ceRNA Network of AD

mRNA	miRNA	lncRNA
HBB	hsa-miR-361-3p	SNHG1, GUSBP11, MALAT1
LCE3D	hsa-miR-1224-5p	NEAT1
S100A8	hsa-miR-98-5p	NUTM2A-AS1, TRG-AS1, XIST, TTTY15
S100A9	hsa-miR-766-5p	RMRP, STAG3L5P-PVRIG2P-PILRB, XIST
		NEAT1, LINC00894, KCNQ1OT1, NUTM2A-AS1
	hsa-miR-588	XIST,NEAT1
	hsa-miR-132-5p	TTN-AS1

Figure 10 Venn diagram showed the miRNAs targeting each hub gene which were predicted in the online database. (A) HBB. (B) LCE3D. (C) S100A7. (D) S100A9. (E) S100A8. Predicted in ≥3 object databases were considered as true.

Figure 11 Venn diagram showed the lncRNAs which were predicted to target the identified miRNA in online database. (A) hsa-miR-361-3p. (B) hsa-miR-513a-5p. (C) hsa-miR-1224-5p. (D) hsa-miR-98-5p. (E) hsa-miR-132-5p. (F) hsa-miR-766-5p. (G) hsa-miR-588. Predicted in ≥4 object databases were considered as true.

Figure 12 The lncRNA–miRNA–mRNA ceRNA network of AD. (A) The ceRNA network was constructed through Cytoscape software. The triangle represents the hub gene, and the circle represents the miRNA and the rhombus represents the lncRNA. The lncRNA whose degree was highest was painted red. (B) The alluvial diagram of the ceRNA network.

Figure 13 RT-qPCR validation of the core lncRNAs of the ceRNA network. (A) The relative expression of XIST between AD and healthy control. (B) The relative expression of NEAT1 between AD and healthy control. *p<0.05.

Abbreviation: AD, atopic dermatitis.