Higher IL-9 Level is Associated with Psoriasis Vulgaris Complicated by Metabolic Syndrome

Figures & data

Table 1 Primer Sequences

Gene	Primer Sequences (5’-3’)
S100A9	F: CCTTCCACCAATACTCTGTGAA
	R: GGTCCTCCATGATGTGTTCTAT
S100A8	F: TATCATCGACGTCTACCACAAG
	R: TCTGCACCCTTTTTCCTGATAT
S100A7	F: CAAATACACCAGACGTGATGAC
	R: TAAGGAAGTTGGGGAAGTTCTC
CXCL8	F: AACTGAGAGTGATTGAGAGTGG
	R: ATGAATTCTCAGCCCTCTTCAA
IL-1β	F: GCCAGTGAAATGATGGCTTATT
	R: AGGAGCACTTCATCTGTTTAGG
HBD-2	F: GCGATCCTGTTACCTGCCTTAAGAG
	R: AGCATTTTGTTCCAGGGAGACCAC
β-actin	F: GTCCACCGCAAATGCTTCTA
	R: TGCTGTCACCTTCACCGTTC

Abbreviations: F, forward; R, reverse; S100A7, S100 calcium-binding protein A7; S100A8, S100 calcium-binding protein A8; S100A9, S100 calcium-binding protein A9; CXCL8, C-X-C motif chemokine ligand 8; IL-1β, interleukin one beta; HBD-2, human beta-defensin 2.

Table 2 Clinical, Sociodemographic, Anthropometric and Biochemical Characteristics of Psoriatic Vulgaris Patients and Controls

	Controls (n=20)	Psoriasis Vulgaris without MetS (n=57)	Psoriasis Vulgaris with MetS (n=75)	P1	P2	P3
Age (years), median (IQR)	30.0 (26.3–43.0)	29.0 (20.5–41.5)	45.0 (34.0–59.0)	0.549	<0.001	<0.001
Sex (male), n (%)	11 (55.00%)	36 (63.15%)	54 (72.00%)	0.52	0.146	0.280
History of smoking, n (%)	4 (20.00)%	12 (21.05%)	28 (37.33%)	0.920	0.145	0.044
History of alcohol consumption, n (%)	1 (5.00%)	4 (7.02%)	12 (16.00%)	0.753	0.365	0.010
Duration of disease (years), n (%)				/	/	0.145
≤10	/	40 (70.17%)	38 (50.67%)
11–20	/	11 (19.30%)	22 (29.33%)
21–30	/	4 (7.02%)	11 (14.67%)
>30	/	2 (3.51%)	4 (5.33%)
Family history of psoriasis	/	9 (15.79%)	7 (9.33%)	/	/	0.260
PASI, median (IQR)	/	8.0 (5.4–18.1)	12.3 (6.0–20.1)	/	/	0.290
Waist circumference (cm), mean ± SD	78.20±7.29	78.56±8.11	98.27±7.57	0.356	<0.001	<0.001
BMI (kg/m2), median (IQR)	21.66 (20.94–22.56)	21.60 (18.60–23.50)	27.80 (25.40–30.80)	0.335	<0.001	<0.001
FBG (mmol/L), median (IQR)	4.61 (4.20–5.00)	4.43 (4.15–4.77)	5.11 (4.83–6.20)	0.315	<0.001	<0.001
Insulin (pmol/L), median (IQR)	/	6.64 (4.35–9.33)	11.59 (7.84–17.23)	/	/	<0.001
HOMA-IR, median (IQR)	/	1.32 (0.85–2.04)	2.54 (1.85–4.60)	/	/	<0.001
SBP (mmHg), mean ± SD	112.35±12.53	117.84±14.48	139.88±15.25	0.114	<0.001	<0.001
DBP (mmHg), mean ± SD	71.20±8.15	74.26±8.54	85.84±9.37	0.162	<0.001	<0.001
Triglycerides (mmol/L), median (IQR)	0.93 (0.82–1.04)	0.90 (0.70–1.11)	2.11 (1.66–3.14)	0.621	<0.001	<0.001
HDL-C (mmol/L), median (IQR)	1.24 (1.17–1.39)	1.31 (1.18–1.52)	0.92 (0.77–1.04)	0.416	<0.001	<0.001

Notes: P₁: psoriasis vulgaris without MetS vs control; P₂: psoriasis vulgaris with MetS vs control; P₃: psoriasis vulgaris without MetS vs psoriasis vulgaris with MetS.

Abbreviations: MetS, metabolic syndrome; PASI, psoriasis area severity index; BMI, body mass index; FBG, fasting blood glucose; HOMA-IR, homeostasis model assessment-insulin resistance; SBP, systolic blood pressure; DBP, diastolic blood pressure; HDL-C, high-density lipoprotein cholesterol; IL, interleukin.

Figure 1 Serum interleukin (IL)-9 level of psoriasis vulgaris patients with metabolic syndrome (PVMS) (n = 75) compared with psoriasis vulgaris patients without metabolic syndrome (PVNMS) (n = 57) and healthy controls (n = 20). Data are expressed as the mean ± SD (A). Serum IL-17A level of PVMS (n = 75) compared with PVNMS (n = 57). Data are expressed as median with interquartile range (B). *P < 0.05, and ***P < 0.001.

Figure 2 Expression of interleukin (IL)-9 in psoriasis vulgaris and normal human skin. IL-9 staining rarely occurred in normal dermis ((A), n = 7), whereas scattered and strong expression was observed in inflammatory cells (red arrow) and vascular endothelial cells (black arrow) in the skin of psoriasis vulgaris patients without metabolic syndrome (PVNMS) ((B), n = 30) or psoriasis vulgaris patients with metabolic syndrome (PVMS) ((C), n = 30), respectively (Scale bar, 50 μm). The expression levels were quantitatively analyzed by Image-pro Plus (D). IOD, integrated optical density. Data are expressed as the mean ± SD. *P < 0.05, **P < 0.01.

Figure 3 Expression of interleukin-9 receptor (IL-9R) in psoriasis vulgaris and normal human skin. Representative images of immunohistochemistry staining are shown for absent, weak, and strong expression of IL-9R in keratinocytes and inflammatory cells of normal skin ((A), n = 7), the skin of psoriasis vulgaris patients without metabolic syndrome (PVNMS) ((B), n = 30) and the skin of psoriasis vulgaris patients with MetS (PVMS), respectively ((C), n = 30). The red arrow indicates the positive expression of IL-9R in the cytomembrane of keratinocytes (Scale bar, 50 μm). The expression levels were quantitatively analyzed by Image-pro Plus (D). IOD, integrated optical density. Data are expressed as the mean ± SD. **P < 0.01, ***P < 0.001.

Table 3 Spearman Correlation Coefficients Between Serum IL-9 Level and Serum IL-17A Level, Clinical Features and Metabolic Syndrome Components in Psoriasis Vulgaris Patients

	IL-9	P
IL-17A	0.414	<0.001
PASI	0.136	0.284
Age	0.015	0.862
History of smoking	−0.083	0.342
History of alcohol consumption	−0.087	0.322
WC	0.362	<0.001
Central obesity	0.336	<0.001
BMI	0.301	0.002
Overweight/obesity	0.353	<0.001
FBG	0.194	0.038
Hyperglycemia	0.252	0.043
HOMA-IR	0.223	0.036
SBP	0.224	0.020
DBP	0.321	0.001
High blood pressure	0.341	<0.001
Triglycerides	0.305	0.001
Hypertriglyceridaemia	0.346	<0.001
HDL-C	−0.310	0.001
Low HDL-C	0.300	0.001
Metabolic syndrome	0.372	<0.001

Abbreviations: IL, interleukin; PASI, psoriasis area severity index; WC, waist circumference; BMI, body mass index; FBG, fasting blood glucose; HOMA-IR, homeostasis model assessment-insulin resistance; SBP, systolic blood pressure; DBP, diastolic blood pressure; HDL-C, high-density lipoprotein cholesterol.

Figure 4 Interleukin (IL)-9 promoted antimicrobial peptides and chemokines gene expression in M5-treated normal human epidermal keratinocytes (NHEKs). NHEKs were treated with M5 (10 ng/mL) for 24 hours and then cultured in the presence or absence of IL-9 (100 ng/mL). The mRNA levels of S100A9 (A), S100A8 (B), S100A7 (C), CXCL8 (D), IL-1β (E) and HBD-2 (F) were measured by qRT-PCR. Data are expressed as the mean ± SD. **P < 0.01, and ***P < 0.001 vs control group; ^#P < 0.05, ^##P < 0.01 and ^###P < 0.001 vs M5 group. S100A7, S100 calcium-binding protein A7; S100A8, S100 calcium-binding protein A8; S100A9, S100 calcium-binding protein A9; CXCL8, C-X-C motif chemokine ligand 8; IL-1β, interleukin 1 beta; HBD-2, human beta-defensin 2.