Predictive Value of Serum microRNA-29b-3p in Recurrence of Atrial Fibrillation After Radiofrequency Catheter Ablation

Figures & data

Table 1 Primer Sequences of RT-qPCR

Gene	Forward 5’-3’	Reverse 5’-3’
miR-29b-3p	GCTCTAGATCAGTTACAGAAAGACCACGA	GCTCTAGATAGTGTCCATGCACGGACC
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT

Table 2 Clinical Baseline Characteristics of the Control Group and AF Group

Factors	Control (N=100)	AF (N=100)	P
Average age (years)	60.7 ± 6.1	61.3 ± 6.1	0.496
Sex (Male/female)	58/42	53/47	0.477
BMI (kg/m^2)	24.1 ± 2.6	23.8 ± 2.1	0.464
Hypertension (Yes/No)	37/63	48/52	0.116
Diabetes (Yes/No)	34/66	42/58	0.244
Smoking history (Yes/No)	54/46	51/49	0.671
Drinking history (Yes/No)	51/49	57/43	0.395
SBP (mmHg)	120.1 ± 10.2	123.2 ± 12.9	0.056
DBP (mmH)	75.2 ± 7.5	76.3±7.6	0.272
LVEF (%)	59.3 ± 5.3	58.5 ± 5.4	0.291
LAD (mm)	37.9 ± 3.2	39.8 ± 3.3	< 0.001
LAVI (mL/m2)	21.6 ± 4.7	37.1 ± 10.6	< 0.001
FGF-21 (pg/mL)	175.4 ± 18.2	250.5 ± 30.0	< 0.001
FGF-23 (ng/mL)	109.5 ± 10.1	208.2 ± 19.6	< 0.001
hs-CRP (mg/L)	4.2 ± 0.2	4.3 ± 0.2	0.072
NT-proBNP (pg/mL)	24.9 ± 5.4	105.5 ± 25.7	< 0.001

Notes: Measurement data were expressed as mean ± standard deviation or number of cases. The comparison between two groups was analyzed by t-test, and the classification variables were analyzed by Fisher’s exact test. Differences were considered statistically significant at P < 0.05.

Abbreviations: BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; LVEF, left ventricular ejection fraction; LAD, left atrial mean diameter; LAVI, left atrium volume index; FGF-21, fibroblast growth factor-21; FGF-23, fibroblast growth factor-23; hs-CRP, hypersensitive C-reactive protein; NT-proBNP, N-terminal B-type natriuretic peptide precursor; AF, Atrial fibrillation.

Figure 1 Expression levels of miR-29b-3p in the serum of AF patients. The serum expression of miR-29b-3p was determined by RT-qPCR. The t-test was used for data comparisons between two groups. ***P < 0.001.

Figure 2 Differential expression of serum miR-29b-3p in AF patients before and after RFCA. The expression levels of serum miR-29b-3p in AF patients before and after RFCA were measured by RT-qPCR. Data comparisons between groups were analyzed by the t-test. *P < 0.05.

Figure 3 Correlation analysis between miR-29b-3p and markers of atrial fibrosis. The Pearson method was used to analyze the correlation between the expression level of miR-29b-3p and serum (A) FGF-21 and (B) FGF-23 levels in the AF group. (A and B) were analyzed by Pearson’s coefficient.

Table 3 Comparison of Preoperative General Clinical Data Between Non-Recurrent and Recurrent AF Groups

Characteristics	Non-Recurrent Group (N=68)	Recurrent Group (N=32)	P value
Age (years)	61.4 ± 6.6	61.0 ± 5.2	0.762
Gender (Male/female)	38/30	15/17	0.399
BMI (kg/m^2)	23.8 ± 2.2	23.9 ± 2.2	0.711
Hypertension (Yes/No)	34/34	14/18	0.560
Diabetes (Yes/No)	27/41	15/17	0.498
Smoking history (Yes/No)	32/36	19/13	0.250
Drinking history (Yes/No)	37/31	20/12	0.446
LVEF (%)	58.4 ± 5.5	58.7 ± 5.4	0.800
LAD (mm)	39.8 ± 3.4	39.8 ± 3.1	0.939
LAVI (mL/m^2)	34.4 ± 10.6	42.9 ± 8.3	< 0.001
FGF-21 (pg/mL)	245.9 ± 31.0	260.2 ± 25.7	0.026
FGF-23 (ng/mL)	205.5 ± 19.5	214.1 ± 18.7	0.039
hs-CRP (mg/L)	4.3 ± 0.2	4.3 ± 0.3	0.668
NT-proBNP (pg/mL)	102.7 ± 26.2	111.3 ± 24.0	0.121

Notes: Measurement data were expressed as mean ± standard deviation or number of cases. The comparison between two groups was analyzed by t-test, and the classification variables were analyzed by Fisher’s exact test. Differences were considered statistically significant at P < 0.05.

Abbreviations: BMI, body mass index; LVEF, left ventricular ejection fraction; LAD, left atrial mean diameter; LAVI, left atrium volume index; FGF-21, fibroblast growth factor-21; FGF-23, fibroblast growth factor-23; hs-CRP, hypersensitive C-reactive protein; NT-proBNP, N-terminal B-type natriuretic peptide precursor.

Figure 4 Low expression of serum miR-29b-3p predicted a high risk of recurrence of AF after RFCA. (A) RT-qPCR was used to determine the differential expression of serum miR-29b-3p between the AF non-recurrent and recurrent groups; (B–E) The ROC curves of serum miR-29b-3p, FGF-21, and FGF-23 levels for the identification of AF recurrence after RFCA; (E) Kaplan-Meier curve analysis. (A) was analyzed using the t-test. ***P < 0.001.

Table 4 Comparison of Postoperative Recurrence of AF in Patients with Different miR-29b Levels

	Recurrence	No Recurrence	Total
miR-29b-3p low expression group	19	31	50
miR-29b-3p high expression group	13	37	50
Total	32	68	100

Table 5 Logistic Regression Analysis of Factors Influencing Postoperative AF Recurrence

Factors	P value	OR	95% CI
LAVI	0.035	1.074	1.005~1.147
FGF-21	0.288	0.985	0.958~1.013
FGF-23	0.256	0.981	0.948~1.014
NT-proBNP	0.078	1.019	0.998~1.041
miR-29b-3p	0.027	0.002	0.000~0.494

Notes: Binary logistic multivariate regression analysis was conducted, and a significance level of P < 0.05 was considered statistically significant.

Abbreviations: LAVI, left atrial volume index; FGF-21, fibroblast growth factor-21; FGF-23, fibroblast growth factor-23; NT-proBNP, N-terminal B-type natriuretic peptide precursor; miR-29b-3p, microRNA-29b-3p; OR, odds ratios; CI, confidence interval.