Association of two FOXP3 polymorphisms with breast cancer susceptibility in Chinese Han women

Figures & data

Table 1 Primers used in this study

SNP_ID	1st-PCRP	2nd-PCRP	UEP_SEQ
rs3761548	ACGTTGGATGTGGGTGCTGAGGGGTAAACT	ACGTTGGATGAAGCCTAGATCTCAGGACTC	GCTCTCTCCCCAACTG
rs3761549	ACGTTGGATGACATCACCTACCACATCCAC	ACGTTGGATGACCCCACAGGTTTCGTTCC	TTTCGTTCCGAGAACT

Abbreviations: SNP, single-nucleotide polymorphism; PCRP, primer for polymerase chain reaction; UEP_SEQ, primer for single nucleotide extension.

Table 2 The comparison of basic characteristics between cases and controls

Characteristics	Cases (560)	Controls (583)	P-value
Age (years, mean ± SD)	49.09±11.02	48.80±8.28	0.612
<49	294	311
≥49	266	272
Menopausal status			0.716
Premenopausal	264	281
Postmenopausal	296	302
Procreative times			0.594
<2	289	291
≥2	271	292
BMI (kg/m^2, mean ± SD)	22.52±2.84	22.95±3.21	0.038

Note: P-value <0.05 was shown in bold

Abbreviation: BMI, body mass index.

Table 3 Genotype frequencies of FOXP3 polymorphism in cases and controls

Model	Genotype	Cases (n, %)	Controls (n, %)	OR (95% CI)	Pa	FPRP
rs3761548 (PHWE =0.895)		559	581
Codominant	C/C	337 (60.3%)	388 (66.8%)	1.00
Heterozygote	C/A	198 (35.4%)	173 (29.8%)	1.32 (1.03–1.69)	0.031	0.228
Homozygote	A/A	24 (4.3%)	20 (3.4%)	1.38 (0.75–2.55)	0.298
Dominant	C/C	337 (60.3%)	388 (66.8%)	1.00
	C/A+A/A	222 (39.7%)	193 (33.2%)	1.32 (1.04-1.69)	0.023	0.228
Recessive	C/C+C/A	535 (95.7%)	561 (96.6%)	1.00
	A/A	24 (4.3%)	20 (3.4%)	1.26 (0.69–2.31)	0.456
Overdominant	C/C+A/A	361 (64.6%)	408 (70.2%)	1.00
	C/A	198 (35.4%)	173 (29.8%)	1.29 (1.01–1.66)	0.042	0.328
Allele	C	872 (78.0%)	949 (81.7%)	1.00
	A	246 (22.0%)	213 (18.3%)	1.26 (1.02–1.54)	0.029	0.184
rs3761549 (PHWE =0.934)		560	582
Codominant	C/C	385 (68.8%)	372 (63.9%)	1.00
Heterozygote	T/C	157 (28%)	187 (32.1%)	0.81 (0.63–1.05)	0.108
Homozygote	T/T	18 (3.2%)	23 (4.0%)	0.76 (0.40–1.42)	0.386
Dominant	C/C	385 (68.8%)	372 (63.9%)	1.00
	T/C-T/T	175 (31.2%)	210 (36.1%)	0.81 (0.63–1.03)	0.084
Recessive	C/C-T/C	542 (96.8%)	559 (96.0%)	1.00
	T/T	18 (3.2%)	23 (4.0%)	0.81 (0.43–1.51)	0.503
Overdominant	C/C-T/T	403 (72.0%)	395 (67.9%)	1.00
	T/C	157 (28.0%)	187 (32.1%)	0.82 (0.64–1.06)	0.132
Allele	C	927 (82.8%)	931 (80.0%)	1.00
	T	193 (17.2%)	233 (20.0%)	0.83 (0.67–1.03)	0.088

Note:

a Adjusted for BMI. OR of significant association is presented in bold.

Abbreviations: BMI, body mass index; CI, confidence interval; FPRP, false-positive report probability; FOXP3, forkhead box P3; HWE, Hardy–Weinberg equilibrium; OR, odds ratio.

Table 4 The association between rs3761548 and clinical features of BC

Variables		OR (95% CI)
		Homozygote	Heterozygote	Dominant	Recessive	Allele
Tumor size	<2 cm	1.00
	≥2 cm	2.51 (0.83–7.64)	1.47 (1.01–2.15)	1.54 (1.07–2.23)	2.19 (0.73–6.61)	1.48 (1.08–2.03)
LN metastasis	(−)	1.00
	(+)	1.61 (0.59–4.40)	1.28 (0.90–1.83)	1.31 (0.92–1.85)	1.47 (0.55–3.99)	1.26 (0.94–1.69)
ER	(−)	1.00
	(+)	0.59 (0.26–1.36)	0.76 (0.54–1.08)	0.74 (0.53–1.04)	0.66 (0.29–1.49)	0.77 (0.58–1.03)
PR	(−)	1.00
	(+)	0.62 (0.30–1.27)	0.77 (0.54–1.10)	0.75 (0.53–1.05)	0.68 (0.34–1.38)	0.78 (0.59–1.02)
Her-2	(−)	1.00
	(+)	2.34 (0.96–5.69)	1.29 (0.88–1.89)	1.37 (0.95–1.98)	2.13 (0.89–5.13)	1.36 (1.01–1.85)
Ki-67	<14%	1.00
	≥14%	1.05 (0.41–2.690)	0.96 (0.67–1.38)	0.97 (0.68–1.38)	1.07 (0.43–2.70)	0.98 (0.73–1.32)

Note: OR of significant association is presented in bold.

Abbreviations: BC, breast cancer; CI, confidence interval; ER, estrogen receptor; LN, lymph node; OR, odds ratio; PR, progesterone receptor.

Table S1 Stratified analyses on association between FOXP3 SNPs and BC risk

SNPs	Genotype						OR (95% CI)
	Case (n =560)			Control (n=583)			Homozygote	Heterozygote	Dominant	Recessive	Allele
rs3761548	C/C	C/A	A/A	C/C	C/A	A/A
Age <49 (n=604)	177	104	13	207	92	11	1.38 (0.60–3.16)	1.32 (0.94–1.87)	1.33 (0.95–1.85)	1.26 (0.55–2.85)	1.26 (0.95–1.67)
Age ≥49 (n=536)	160	94	11	181	81	9	1.38 (0.56–3.42)	1.31 (0.91–1.89)	1.32 (0.93–1.88)	1.26 (0.51–3.09)	1.25 (0.93–1.69)
Premenopausal (n=544)	159	94	11	187	83	10	1.29 (0.54–3.13)	1.33 (0.93–1.92)	1.33 (0.94–1.88)	1.17 (0.49–2.81)	1.25 (0.93–1.68)
Postmenopausal (n=596)	178	104	13	201	90	10	1.47 (0.63–3.43)	1.30 (0.92–1.85)	1.32 (0.95–1.85)	1.34 (0.58–3.11)	1.26 (0.95–1.68)
rs3761548	C/C	T/C	T/T	C/C	T/C	T/T
Age <49 (n=604)	202	82	10	198	100	12	0.82 (0.35–1.93)	0.80 (0.57–1.14)	0.81 (0.57–1.13)	0.87 (0.37–2.06)	0.85 (0.63–1.13)
Age ≥49 (n=538)	183	74	9	174	87	11	0.78 (0.31–1.92)	0.81 (0.56–1.17)	0.81 (0.56–1.15)	0.83 (0.34–2.04)	0.83 (0.61–1.13)
Premenopausal (n=544)	182	74	8	179	90	11	0.72 (0.28–1.82)	0.81 (0.56–1.17)	0.80 (0.56–1.14)	0.76 (0.30–1.93)	0.83 (0.61–1.12)
Postmenopausal (n=598)	204	83	9	193	97	12	0.71 (0.29–1.72)	0.81 (0.57–1.15)	0.80 (0.57–1.12)	0.76 (0.31–1.83)	0.82 (0.61–1.10)

Abbreviations: BC, breast cancer; CI, confidence interval; FOXP3, forkhead box P3; OR, odds ratio; SNP, single-nucleotide polymorphism.

Table S2 The association between rs3761549 and clinical features of BC

Variables		OR (95% CI)
		Homozygote	Heterozygote	Dominant	Recessive	Allele
Tumor size	<2 cm	1.00
	≥2 cm	0.85 (0.28–2.59)	0.84 (0.59–1.18)	0.84 (0.60–1.18)	0.91 (0.30–2.75)	0.87 (0.65–1.17)
LN metastasis	(−)	1.00
	(+)	1.43 (0.63–3.25)	0.74 (0.52–1.05)	0.81 (0.58–1.13)	1.66 (0.74–3.71)	0.92 (0.71–1.19)
ER	(−)	1.00
	(+)	1.02 (0.40–2.59)	1.26 (0.88–1.79)	1.24 (0.88–1.75)	0.97 (0.39–2.43)	1.15 (0.86–1.54)
PR	(−)	1.00
	(+)	1.04 (0.35–3.07)	0.84 (0.59–1.18)	0.85 (0.60–1.19)	1.12 (0.38–3.26)	0.90 (0.67–1.19)
Her-2	(−)	1.00
	(+)	1.12 (0.33–3.79)	0.95 (0.65–1.37)	0.95 (0.66–1.38)	1.14 (0.34–3.84)	0.98 (0.71–1.33)
Ki-67	<14%	1.00
	≥14%	0.59 (0.26–1.36)	0.72 (0.42–1.25)	0.68 (0.43–1.10)	0.62 (0.27–1.41)	0.68 (0.45–1.01)

Abbreviations: BC, breast cancer; CI, confidence interval; ER, estrogen receptor; LN, lymph node; OR, odds ratio; PR, progesterone receptor.