Construction of a GLUT-1 and HIF-1α gene knockout cell model in HEp-2 cells using the CRISPR/Cas9 technique

Figures & data

Table 1 Added samples of glucose detection

Samples	Sample blank tube	Reagent blank tube	Test tube
Glucose detection reagent/mL		1.0	1.0
Sample volume/µL	100		100
Deionized water/mL	1.0	100

Notes: The samples were mixed well and reacted at room temperature for 15 minutes. The absorbency of each tube was measured at 340nm.

Table 2 Added samples of lactic acid detection

Samples	Blank tube	Standard tube	Test tube
Distilled water/mL	0.02
3 mmol/mL standard liquid/mL		0.02
Sample/mL			0.02
Enzyme working liquid/mL	1	1	1
Developing agent/mL	0.2	0.2	0.2
	Mixing, 37°C water bath for 10 minutes
Stop buffer/mL	2	2	2
	Mixing, 530 nm detection of absorbance value

Note: Content of lactic acid = (testing OD–blank OD)/(standard OD–blank OD) × concentration of standard substance.

Table 3 sgRNA sequences of GLUT-1 and HIF-1α

sgRNA	Sequences
Glut-1-sgRNA-L	GGATGCTCTCCCCATAGCGG TGG
Glut-1-sgRNA-R	GCCACCACGCTCACCACGCTC TGG
HIF-1α-sgRNA-L	GAACTCACATTATGTGGAAG TGG
HIF-1α-sgRNA-R	GTTGATAAGGCCTCTGTGATG AGG

Abbreviations: GLUT, glucose transporter; HIF-1α, hypoxia-inducible factor-1α; sgRNAs, small-guide RNAs.

Figure 1 sgRNAs design of HIF-1α and GLUT-1 genomic region.

Notes: (A) GLUT-1 sgRNAs were designed to specially identify exon 3 of the GLUT-1 genomic region. Yellow: exon 3; green: sgRNA-L; blue: sgRNA-R. (B) HIF-1α sgRNAs were designed to specially identify exon 2 of the HIF-1α genomic region. Yellow: exon 2; green: sgRNA-L; blue: sgRNA-R.

Abbreviations: GLUT, glucose transporter; HIF-1α, hypoxia-inducible factor-1α; sgRNAs, small-guide RNAs.

Table 4 Primers of Glut-1 and HIF-1α

Primers	Sequences
<g>GLUT1_detect_F	<g>TCCACCACTGATCACTTGCC
GLUT1_detect_R	CCCAGTTTCGAGAAGCCCAT
<g>HIF1_detect_F	<g>TGGACTTTTTGTGAGAGTTCCT
HIF1_detect_R	GGGAGGGGAAAAGCCAGTAT

Abbreviations: GLUT, glucose transporter; HIF-1α, hypoxia-inducible factor-1α.

Figure 2 Mutation sequence of GLUT-1 in positive cells.

Notes: (A) Schematic diagram of the GLUT-1 sgRNAs generated via the CRISPR/Cas9 system. (B) TA clone sequence of the PCR amplification products from the GLUT-1 genomic region.

Abbreviations: GLUT, glucose transporter; sgRNAs, small-guide RNAs.

Figure 3 Mutation sequence of HIF-1α in positive cells.

Notes: (A) Schematic diagram of the HIF-1α sgRNAs generated via the CRISPR/Cas9 system. (B) TA clone sequence of the PCR amplification products from the HIF-1α genomic region.

Abbreviations: HIF-1α, hypoxia-inducible factor-1α; sgRNAs, small-guide RNAs.

Figure 4 Measurement of HIF-1α and GLUT-1 expression in positive cells by immunoblotting.

Notes: (A) The results of Western blot. (B) There was a significantly decreased HIF-1α and GLUT-1 protein after HIF-1α and GLUT-1 double gene knockout compared with before HIF-1α and GLUT-1 double gene knockout (P<0.001, respectively). HEp-2-WT: control cells. β-Actin served as the internal control. **P<0.001.

Abbreviations: GLUT, glucose transporter; HIF-1α, hypoxia-inducible factor-1α.

Figure 5 Effects of HIF-1α and GLUT-1 double gene knockout on proliferation of HEp-2 cells detected by CCK-8.

Note: *P<0.05, **P<0.01.

Abbreviations: CCK-8, cell counting kit-8; GLUT, glucose transporter; HIF-1α, hypoxia-inducible factor-1α.

Figure 6 Effects of HIF-1α and GLUT-1 double gene knockout on the migration or invasive capacity of HEp-2 cells assessed by Transwell assays.

Notes: (A) The migration capacities of cells were significantly lower after HIF-1α and GLUT-1 double gene knockout compared with before HIF-1α and GLUT-1 double gene knockout. (B) The invasive capacities of cells were significantly lower after HIF-1α and GLUT-1 double gene knockout compared with before HIF-1α and GLUT-1 double gene knockout.

Abbreviations: GLUT, glucose transporter; HIF-1α, hypoxia-inducible factor-1α.

Figure 7 Effects of HIF-1α and GLUT-1 double gene knockout on glucose uptake and lactic acid generation of HEp-2 cells.

Notes: There was a significantly reduced glucose uptake (A) and lactic acid generation (B) after HIF-1α and GLUT-1 double gene knockout compared with before HIF-1α and GLUT-1 double gene knockout (P=0.005 and P=0.012, respectively). **P<0.01.

Abbreviations: GLUT, glucose transporter; HIF-1α, hypoxia-inducible factor-1α.

Figure 8 Effects of HIF-1α and GLUT-1 double gene knockout on PI3K/Akt/mTOR pathway detected by Western blots.

Notes: (A) The results of Western blot. (B) There was a significantly increased relative expression of PTEN and decreased p-PI3K, PI3K, p-AKT, AKT, and mTOR protein after HIF-1α and GLUT-1 double gene knockout compared with before HIF-1α and GLUT-1 double gene knockout (P=0.008, P=0.005, P=0.03, P=0.001, P=0.029, and P=0.007, respectively).