Upregulation of long noncoding RNA LINC00152 promotes proliferation and metastasis of esophageal squamous cell carcinoma

Figures & data

Figure 1 LINC00152 is overexpressed in ESCC tissues.

Notes: (A) LINC00152 is upregulated in ESCC tissue compared with paired normal tissues in the GEO database (GSE53624). (B) LINC00152 was detected in 69 pairs of ESCC tissues by qRT-PCR. The levels of LINC00152 in ESCC tissues were significantly higher than those in nontumorous tissues. **P<0.01, ***P<0.001.

Abbreviation: ESCC, esophageal squamous cell carcinoma.

Figure 2 Relationship between LINC00152 expression and clinical features and prognosis in patients with esophageal cancer. LINC00152 expression was detected by ISH in 105 ESCC tissues.

Notes: (A and C) Low expression of LINC00152 in ESCC tissue, total score <4, n=19. (B and D) High expression of LINC00152 in ESCC tissue, total score ≥4, n=86. (E) ESCC patients with high LINC00152 expression showed shorter OS compared with patients with low LINC00152 expression by Kaplan–Meier survival curve according to the results of ISH (P=0.007).

Abbreviations: ESCC, esophageal squamous cell carcinoma; ISH, in situ hybridization.

Table 1 Correlation between LINC00152 expression and clinicopathological characteristics

	Variables	LINC00152 expression		Total	rs	P-value
Low	High
Age (years)					0.013	0.908
	≤65	10	44	54
	＞65	9	42	51
Sex					1.228	0.268
	Female	7	21	28
	Male	12	65	77
T stage					1.434	0.231
	T1/T2	5	11	16
	T3/T4	13	73	86
	Null			3
N stage					4.691	0.03*
	N0	13	34	47
	N1/N2/N3	6	49	55
	Null			3
TNM stage					7.798	0.005**
	I/II	14	34	48
	III	4	48	52
	Null			5
Grade					0.259	0.611
	1/2	16	65	81
	3	3	21	24
P53					0.521	0.47
	Negative	7	21	28
	Positive	11	49	60
	Null			17
Ki67					0.465	0.495
	Negative	6	32	38
	Positive	12	44	56
	Null			11

Notes: *P<0.05, **P<0.01.

Table 2 Univariate and multivariate analyses of factors correlated with overall survival of esophageal cancer patients

Variables	Univariate analysis			Multivariate analysis
	HR	95% CI	P-value	HR	95% CI	P-value
LINC00152	1.917	1.175–3.129	0.009**	1.735	0.936–3.214	0.045*
Grade	1.357	0.838–2.200	0.215
Sex	1.796	1.065–3.028	0.028*	1.546	0.811–2.945	0.186
Age (years)	0.879	0.574–1.346	0.554
T stage	2.743	1.361–5.531	0.005**	1.311	0.562–3.061	0.531
N stage	2.044	1.309–3.193	0.002**	0.447	0.126–1.594	0.215
TNM stage	2.841	1.770–4.560	0.000***	4.978	1.247–19.871	0.023*
P53	1.826	1.072–3.110	0.027*	1.269	0.699–2.302	0.433
Ki67	1.085	0.683–1.722	0.731

Notes: *P<0.05, **P<0.01, ***P<0.001.

Figure 3 LINC00152 promotes the proliferation of ESCC cells.

Notes: (A) LINC00152 expression in the indicated cell lines. (B) LINC00152 expression in ECSS cells after transfection of si-NC (negative control) or two siRNAs targeting LINC00152. siRNA-1 showed better inhibition efficiency. (C) Cell proliferation assay by CCK-8. Compared with NC, siRNA-mediated silencing of LINC00152 significantly inhibited cell proliferation. (D) Cell proliferation assay by RTCA. Depletion of LINC00152 reduced both TE1 and TE13 cell line proliferation. *P<0.05, **P<0.01.

Abbreviation: ESCC, esophageal squamous cell carcinoma.

Figure 4 LINC00152 impacts the cell cycle but not apoptosis of ESCC cells.

Notes: (A) siRNA treatment significantly blocked TE1 and TE13 cells at S phase. (B) Silencing of LINC00152 had no impact on the apoptosis of ESCC cells. *P<0.05, **P<0.01.

Abbreaviation: ESCC, esophageal squamous cell carcinoma.

Figure 5 LINC00152 promotes the migration and invasion of ESCC cell lines.

Notes: (A) Compared with negative controls, ESCC cells transfected with siRNA against LINC00152 showed weaker migration ability in Transwell migration assays. **P<0.01. (B) In Matrigel invasion assay, ESCC cells transfected with siRNA against LINC00152 showed significantly impaired invasion capacity compared with controls. *P<0.05, **P<0.01.

Abbreviation: ESCC, esophageal squamous cell carcinoma.

Figure 6 LINC00152 regulates ESCC progression by different ways.

Notes: (A) Gene set enrichment analysis (GSEA) of the microarray results of ESCC cells with LINC00152 knockdown. (B) Western blot assay showed that LINC00152 knockdown significantly increased the expression of MAD2L1, CDK6 and STX3, while the protein level of STX12 was decreased compared with controls. *P<0.05, **P<0.01.

Abbreviation: ESCC, esophageal squamous cell carcinoma.

Table S1 The sequence of primers and synthetic siRNAs

Primer	Forward	Reverse
LINC00152	AAAATCACGACTCAGCCCCC	AATGGGAAACCGACCAGACC
GAPDH (glyceraldehyde-3-phosphate dehydrogenase)	AGGGCTGCTTTTAACTCTGGT	CCCCACTTGATTTTGGAGGGA
siRNAs	Sense（5’-3’）	Antisense（5’-3’）
siRNA1-LINC00152	CCUCUUGACUCUUCUGUGATT	UCACAGAAGAGUCAAGAGGTT
siRNA2-LIINC00152	GGAGAUGAAACAGGAAGCUTT	UUCUCCGAACGUGUCACGUTT
siRNA-NC	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT