CircRNA hsa_circ_0004585 as a potential biomarker for colorectal cancer

Figures & data

Table 1 Primers for RT-PCR

circRNA	Primers type	5ʹ-3’
hsa_circ_0072568	Forward	GAACTGTACGAAACAACTTTGCTG
	Reverse	GTGCCATTGTCCACATCAAAAC
hsa_circ_0072566	Forward	AGATCACCCATGTGCAACCA
	Reverse	TGGCCAAGACCTGTTATGGTG
hsa_circ_0072567	Forward	GCCACCATAACAGACACGGA
	Reverse	TGGCCAAGACCTGAGCAAAT
hsa_circ_0074033	Forward	CAGCCAACAGACCTCAGGAA
	Reverse	CAAGGAGCCTGGAAAACGCT
hsa_circ_0074039	Forward	CAGCCAACAGACCTCAGGAA
	Reverse	AGTGGTAGGGCTAGTCGCA
hsa_circ_0004585	Forward	CAAGACTGCAAGGAGCACACTG
	Reverse	AGAGTGAGCCAGCTGATGGT

Abbreviation: RT-PCR, real-time polymerase chain reaction.

Figure 1 Identification of the differentially expressed circRNAs between CRC tissue and adjacent. (A) The cluster graph of the samples, red is relatively high expression, blank is medium, and green is relatively low expression. CA1, CA2, CA3, and CA4 are colorectal cancer tissues, and AP1, AP2, AP3, and AP4 are corresponding adjacent normal tissue. (B) The scatter plot, the values spotted in the X and Y axes represent the normalized signals of samples in the two groups (log2-scaled). (C) The volcano plot, the Y axes is -log10 (P-values) and the X axes is log2 (fold change). Among them, the red color is the up-regulated gene, the green color is the down-regulated gene, and the black color is the no significant difference gene.

Figure 2 Twenty differently expressed circRNAs in the colorectal cancer (the fold-change ≥5 or ≤-5, P-value<0.01 and the ProcessedSignal≥100). Red is relatively high expression, green is relatively low expression. CA1, CA2, CA3, and CA4 are colorectal cancer tissues, and AP1, AP2, AP3, and AP4 are corresponding adjacent normal tissue. The first 11 are high expression circRNAs, the rest are low expression circRNAs.

Figure 3 The enriched disease terms. The top 10 most significant enriched, (A) KEGG diseases terms, (B) FunDO terms, and (C) OMIM terms.

Figure 4 Validation of differential expression circRNAs by qRT-PCR in CRC and adjacent tissues. Scatterplots display the relative expression of specific circRNAs between CRC (Tumor) and adjacent tissues (Control). Scatter plot drawing with △CT value between CRC and adjacent tissues in Graphpad Software. hsa_circ_0004585, hsa_circ_0074033, and hsa_circ_0074039 are higher expression, hsa_circ_0072566, hsa_ circ_72567, and hsa_circ_72568 are downregulated in CRC tissue.

Figure 5 The expression level of hsa_circ_0004585. (A) The expression of hsa_circ_0004585 in 142 CRC patients’ peripheral samples compared with the normal healthy person group. (B and C) hsa_circ_0004585 was significantly upwnregulated in 92% (46/50) of 50 colorectal cancer patient tissues and the adjacent normal tissues.

Abbreviation: CT, cycle threshold.

Table 2 Correlation between hsa_circ_0004585 expression and clinicopathological characteristics in 50 colorectal cancer patients

Characteristics	No of cases	Mean±SD	P-value
Age (years)
≤60	19	5.266±3.520	0.520
>60	31	6.087±4.782
Gender
Male	20	5.282±4.172	0.516
Female	30	6.104±4.465
Tumor size
≤5cm	33	6.655±4.725	0.044*
>5cm	17	4.068±2.823
Clinical stage
I & II	20	6.256±3.615	0.527
III & IV	30	5.455±4.774
CA19–9
−	41	5.412±3.996	0.208
+	9	7.419±5.570
CEA
−	30	5.756±4.453	0.970
+	20	5.804±4.241

Note: *P<0.05.

Abbreviations: CA19-9, carbohydrate antigen 19-9; CEA, carcino-embryonic antigen.

Table 3 Validation of the selected circRNAs by qPCR and ROC analysis

CircRNA	Expression^a		AUC	P-value	Sensitivity	Specificity
CRC tissues	Adjacent tissues
has_circ-0004585	8.47±1.34	9.09±1.37	0.731	0.000**	0.851	0.511
hsa_circ_0002568	10.37±2.75	8.27±3.08	0.665	0.021*	0.792	0.523
hsa_circ_0002566	10.62±2.17	7.70±2.20	0.717	0.000**	0.697	0.509
hsa-circ-0002567	10.84±1.76	8.01±2.08	0.726	0.000**	0.875	0.629
hsa-circ-0074033	3.31±2.12	5.84±3.67	0.721	0.002**	0.785	0.607
hsa-circ-0074039	2.56±1.84	4.74±2.79	0.728	0.001**	0.846	0.667

Notes: ^aThe expression of each circRNA was calculated from the ΔCt and expressed as mean±standard deviation; * P<0.05; ** P<0.01.

Abbreviations: AUC, area under the curve; CRC, colorectal cancer; qPCR, quantitative polymerase chain reaction; ROC, receiver operating characteristic.

Figure 6 (A) ROC analysis for the expression hsa_circ_0004585 in 50 paired tissue of CRC patients. (B) ROC curves of the CRC person serum for the hsa_circ_0004585 expression.

Abbreviations: AUC, area under curve; ROC, receiver-operating characteristic.

Table 4 More binding sites of miRNA with hsa_circ_0004585 top 20

miRNA ID	miRanda binding site (position)	Target scan binding site (positions)	Binding numbers
hsa-miR-299-3p	1720	1555 1594 1736 241 99 1560 1599 1743 246 104	11
hsa-miR-431-5p	183	170 198 2008 511 977 175 205 2014 516 982	11
hsa-miR-4657	222 89	1555 1594 1737 240 99 1560 1599 1743 246 104	11
hsa-miR-4691-5p	1276	1293 1453 1527 1873 326 1299 1458 1533 1879 331	11
hsa-miR-15b-5p	884	113 207 23 898 118 213 28 904	9
hsa-miR-3912-5p	869	1470 477 497 882 1475 483 502 888	9
hsa-miR-424-5p	192	113 207 23 898 118 213 28 904	9
hsa-miR-497-5p	884	113 207 23 898 118 213 28 904	9
hsa-miR-6736-3p	548 7	1642 20 332 561 1649 26 337 567	10
hsa-miR-6778-3p	15	253 29 458 542 260 36 463 547	9
hsa-miR-6801-5p	64	126 59 626 79 132 65 632 85	9
hsa-miR-6838-5p	193 884	113 207 23 898 118 213 28 904	10
hsa-miR-1262	1048 500	1063 1734 520 1069 1739 526	8
hsa-miR-23a-5p	140	153 1922 300 159 1928 305	7
hsa-miR-23b-5p	1908 139	153 1922 300 159 1928 305	8
hsa-miR-4701-3p	508	1063 1734 520 1069 1739 526	7
hsa-miR-4709-3p	29	1854 44 854 1859 51 859	7
hsa-miR-4764-5p	229	100 1992 308 107 1997 314	7
hsa-miR-4769-3p	519	1422 533 699 1427 540 705	7
hsa-miR-5695	806	1291 1630 819 1297 1636 825	7

Figure 7 The hsa_circ_0004585 structure and miRNA binding sites, including origin gene KIAA1199, exon2–exon14 composed this circRNA, this gene from Chromosome 15, location between 81,166,204 and 81,212,640, the molecule is 2019 bp and binding miRNA top 20 (Table3).