Impact Analysis of miR-1253 on Lung Cancer Progression Through Targeted Regulation of ANXA3

Figures & data

Table 1 Primer Sequence Table

Factors	Upstream Primer 5ʹ-’3	Downstream Primer 5ʹ-’3
miR-1253	GCTGTAACAGCGGCGGAACTCC	ATCCGCAGGAGTGTCCGAG
U6	GCTTCGGCAGCACATATACTAAAAT	CGCTTCACGAATTTGCGTGTCAT
ANXA3	ACAGCGGCAGCTGATTGTTA	TCACTAGGGCCACCATGAGA
GAPDH	GGATATTGTTGCCATCAATGACC	AGCCTTCTCCATGGTGGTGAAGA

Table 2 Relationship Between miR-1253 and Clinicopathological Data of LC Patients

Factors		miR-1253		x^2 value	P value
		Low Expression (n=59)	High Expression (n=43)
Age				0.019	0.891
	≥ 58 years old (n=53)	31 (52.54)	22 (51.16)
	< 58 years old (n=49)	28 (47.46)	21 (48.84)
Gender				0.218	0.641
	Male (n=62)	37 (62.71)	25 (58.14)
	Female (n=40)	22 (37.29)	18 (41.86)
TNM stage				19.63	<0.001
	Stages I–II (n=57)	22 (37.29)	35 (81.40)
	Stages III (n=45)	37 (62.71)	8 (18.60)
Differentiation				31.30	<0.001
	Low differentiation (n=63)	50 (84.75)	13 (30.23)
	Moderate + high differentiation (n=39)	9 (15.25)	30 (69.77)
Lymphatic metastasis				7.572	0.001
	Metastasis (n=37)	28 (47.46)	9 (20.93)
	No metastasis (n=65)	31 (52.54)	34 (79.07)
Mycoplasma infection				0.003	0.955
	Positive (n = 40)	23(38.98)	17(39.53)
	Negative (n = 62)	36(61.02)	26(60.47)

Figure 1 Expression and clinical significance of miR-1253 and ANXA3 in LC. (A) miR-1253 expression in LC tissues. (B) ANXA3 expression in LC tissues. (C) ROC of miR-1253 in diagnosing LC. (D) Correlation analysis between miR-1253 and ANXA3. (E) miR-1253 expression in LC cells. (F) ANXA3 expression in LC cells. * Indicates P<0.05.

Figure 2 Effect of miR-1253 on proliferation, invasion and apoptosis of LC cells. (A) miR-1253 expression in LC cells after transfection. (B) Effect of miR-1253 on proliferation of LC cells. (C) Effect of miR-1253 on invasion ability of LC cells. (D) Effect of miR-1253 on apoptosis of LC cells. (E) Effect of miR-1253 on apoptosis-related cells in LC cells. * Indicates P<0.05.

Figure 3 Effect of downregulation of ANXA3 expression on proliferation, invasion and apoptosis of LC cells. (A) ANXA3 expression in LC cells after transfection. (B) Effect of ANXA3 on proliferation of LC cells. (C) Effect of ANXA3 on the invasive ability of LC cells. (D) Effect of ANXA3 on apoptosis of LC cells. (E) Effect of ANXA3 on apoptosis-related cells in LC cells. * Indicates P<0.05.

Figure 4 Dual-luciferase reporter enzyme. (A) Effect of miR-1253 on ANXA3 dual-luciferase reporter enzyme activity. (B) Effect of miR-1253 on ANXA3 protein expression. * Indicates P<0.05.

Figure 5 Rescue experiment. (A) Effect of miR-1253-inhibitor+si-ANXA3 on proliferation of LC cells. (B) Effect of miR-1253-inhibitor+si-ANXA3 on invasion ability of LC cells. (C) Effect of miR-1253-inhibitor+si-ANXA3 on apoptosis rate of LC cells. (D) Effect of miR-1253-inhibitor+si-ANXA3 on apoptosis-related proteins in LC cells. * Indicates P<0.05.