MiR-139-5p Targetedly Regulates YAF2 and Mediates the AKT/P38 MAPK Signaling Pathway to Alleviate the Metastasis of Non-Small Cell Lung Cancer Cells and Their Resistance Against Cisplatin

Figures & data

Table 1 Baseline Data [n (%)]

Factors	NSCLC Patients (n=94)
Sex
Male	55 (58.51)
Female	39 (41.49)
Age (year)
≤62	44 (46.81)
>62	50 (53.19)
BMI (kg/m^2)
≤23	46 (48.94)
>23	48 (51.06)
Smoking history
Yes	51 (54.26)
No	43 (45.74)
Tumor size
≥3cm	31 (32.98)
<3cm	63 (67.02)
TNM staging
Stage I–II	64 (68.09)
stage III	30 (31.91)
Differentiation
Low differentiation	56 (59.57)
Medium + high differentiation	38 (40.43)
Lymphatic metastasis
Yes	37 (36.17)
No	57 (60.64)

Table 2 Primer Sequences

Factors	Upstream Primer (5ʹ-3ʹ)	Downstream Primer (5ʹ-3ʹ)
MiR-139-5p	GCCTCTACAGTGCACGTGTCTC	CGCTGTTCTCATCTGTCTCGCGC
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
YAF2	GTTACTGGGACTGTAGCGTCT	TTCCGCACATCGCACATCAT
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Figure 1 The expression of miR-139-5p and YAF2mRNA in NSCLC. (A), The expression of miR-139-5p in NSCLC tissues. (B), The expression of YAF2 mRNA in NSCLC tissues. (C), The expression of miR-139-5p in NSCLC cells. (D), The expression of YAF2mRNA in NSCLC cells. (E), Correlation analysis between miR-139-5p and YAF2 in NSCLC. (F), Effects of miR-139-5p on the prognosis of NSCLC patients. *Indicates P<0.05.

Figure 2 Effects of miR-139-5p on proliferation, invasion, and apoptosis of NSCLC cells. (A), The expression of miR-139-5p in transfected NSCLC cells. (B), Effects of miR-139-5p on proliferation of NSCLC cells. (C), Effects of miR-139-5p on invasion of NSCLC cells. (D), Effects of miR-139-5p on apoptosis of NSCLC cells. (E), Effects of miR-139-5p on apoptosis-related proteins in NSCLC cells. *Indicates P<0.05.

Figure 3 Effects of miR-139-5p on the resistance against DDP. (A), IC50 of DDP against H1975, A549, and A549/DDP cells. (B), IC50 of DDP against H1975 cells after regulation of miR-139-5p. (C), IC50 of DDP againstA549 cells after regulation of miR-139-5p. (D), IC50 of DDP against A549/DDP cells after regulation of miR-139-5p.

Figure 4 Targeting of miR-139-5p to YAF2. (A), DLR assay. (B), Effects of miR-139-5p on the YAF2 protein and AKT/p38 MAPK signaling pathway in NSCLC cells. *Indicates P<0.05.

Figure 5 Effects of down-regulating YAF2 on proliferation, invasion, apoptosis and DDP resistance of NSCLC cells. (A), The expression of YAF2 in transfected NSCLC cells. (B), Effects of YAF2on the proliferation of NSCLC cells. (C), Effects of YAF2on the invasion of NSCLC cells. (D), Effects of YAF2on the apoptosis of NSCLC cells. (E), Effects of YAF2on the apoptosis-related proteins of NSCLC cells. (F), Effects of YAF2 on the DDP resistance of H1975, A549, and A549/DDP cells. *Indicates P<0.05.

Figure 6 Effects of inhibiting the AKT/p38 MAPK signaling pathway on NSCLC cells. (A), Effects of MK2206 on the AKT/p38 MAPK signaling pathway in NSCLC cells. (B), Comparison of cell survival rate. (C), Comparison of cell invasion ability. (D), Comparison of cell apoptosis rate. (E), The expression of apoptosis-related proteins in NSCLC cells. *Indicates P<0.05; #indicates P<0.05.