Long Non-Coding RNA AC118344.1 Promotes Gastric Cancer Cell Proliferation, Invasion, and Metastasis via AKT2 and Its Downstream Molecules HK2 and MMP2

Figures & data

Table 1 Primers and shRNA Sequences of AC11834.4

Name	Sequences
pcDNA3.1^+-AC118344.1 primers	Sense (5’-3’) CGCAAGCTTAACACAGGCTGGCTGTGAAG
AC118344.1 shRNA	Antisense (5’-3’) CTCTCTAGATCCTGAAAAGGTCTGGGTAC 5’ccggGCGACGUGGGUCAGGGAUUTCTCTTCAAAAUCCCUGACCCACGUCGCTTTTTg-3’

Figure 1 Upregulation of AC118344.1 expression in 6 human gastric cancer cells. **Indicates p <0.01.

Figure 2 CCK-8 assay detection of AGS and SGC-7901 cells proliferation. (A) The results of AGS cells proliferation assays. (B) The results of SGC-7901 cell proliferation assays. NC: Untransfected cells (wild-type cells); Vector: Transducted with pcDNA3.1+ empty vector; AC118344.1: Overexpression AC118344.1; scramble shRNA: Transfected with scramble shRNA; shAC118344.1: Transfected with AKT2 shRNA. *Indicates p < 0.05. **Indicates p < 0.01.

Figure 3 AC118344.1 improved gastric cancer cells invasion. (A and B) AGS cells invasion assay; (C and D) SGC-7901 cells invasion assay. NC: Untransfected cells (wild-type cells); Vector: Transducted with pcDNA3.1+ empty vector; AC118344.1: Overexpression AC118344.1; scramble shRNA: Transfected with scramble shRNA; shAC118344.1: Transfected with AKT2 shRNA. **Indicates p < 0.01.

Figure 4 Overexpression of AC118344.1 promoted lung metastatic nodules in nude mice. (A) Lung metastatic burden in BALB/c nude mice; (B) the lung metastatic nodule numbers; (C) representative HE staining of metastatic foci in the lung tissues; (D) lung metastatic tumor area/total lung area. NC: Untransfected cells (wild-type cells); Vector: Transducted with pcDNA3.1+ empty vector; AC118344.1: Overexpression AC118344.1; scramble shRNA: Transfected with scramble shRNA; shAC118344.1: Transfected with AKT2 shRNA. **Indicates p < 0.01.

Figure 5 AC118344.1 promotes the progression of gastric cancer cells by AKT2 and its downstream molecules MMP2 and HK2 except STAT3. (A and B) Overexpression/knockdown of AC118344.1 promoted/inhibited the expression of AKT2 in the indicated AGS (A) and SGC-7901 cells (B); (C and D) overexpression/knockdown of AKT2 did not change the expression of AC118344.1 in the indicated AGS (C) and SGC-7901 cells (D); (E and F) Western blot for AKT2, HK2, MMP2, STAT3 and p-STAT3 expression in the indicated AGS (E) and SGC-7901 cells (F). **Indicates p < 0.01.