MALAT-1 is Associated with the Doxorubicin Resistance in U-2OS Osteosarcoma Cells

Figures & data

Table 1 The Primer Sequence for Knockdown of MALAT-1 in Drug-Resistant Cells

Name		Sequences
MALAT1-Target1	Forward	5ʹ-GAUCCAUAAUCGGUUUCAA-3ʹ
MALAT1-Target1	Reverse	5ʹ- UUGAAACCGAUUAUGGAUC −3ʹ
MALAT1-Target2	Forward	5ʹ- UUAGCGGAAGCUGAUCUCCAA −3ʹ
MALAT1-Target2	Reverse	5ʹ- UUGGAGAUCAGCUUCCGCUAA −3ʹ
Negative control	Forward	5ʹ- UUCUCCGAACGUGUCACGUTT −3ʹ
Negative control	Reverse	5ʹ- ACGUGACAGGUUCGGAGAATT −3ʹ

Figure 1 Effects of methotrexate (A), doxorubicin (B), cisplatin (C), ifosfamide (D) on MALAT-1 expression in U-2OS osteosarcoma cells. The cells treated with doxorubicin demonstrated a relatively good trend of upregulated MALAT-1.

Figure 2 Changes in MALAT-1 expression and the proliferation in U-2OS cells. (A) MALAT-1 expression upregulated in doxorubicin-resistant U-2OS cells. (B) Target-1 (U-2OS DR/shMALAT1-1) demonstrated a higher efficiency than Target-2 (U-2OS DR/shMALAT1-2) in downregulating MALAT-1 expression in doxorubicin-resistant U-2OS cells. (C and D) The doxorubicin-resistant U-2OS osteosarcoma cells displayed more colonies than other cells. (E and F) EdU assay showed that more EdU positive cells in doxorubicin-resistant cells. (G and H) The percentage of cells in the G2/M phase decreased and that in the G1 phase increased while downregulating MALAT-1 in the doxorubicin-resistant U-2OS cells.

Notes: ** P < 0.01. *P < 0.05.
Abbreviations: DS, doxorubicin-sensitive U-2OS cells; DR, doxorubicin-resistant U-2OS cells; shCtrl, negative control; shMALAT1, downregulating MALAT-1 with shRNA.

Figure 3 The doxorubicin-resistant cells exhibited better wound healing ability (A), migration ability (B and C), invasion ability (D and E), which could be reversed by downregulating MALAT-1.

Note: **P<0.01.
Abbreviations: DS, doxorubicin-sensitive U-2OS cells; DR, doxorubicin-resistant U-2OS cells; shCtrl, negative control; shMALAT1, downregulating MALAT-1 with shRNA.

Figure 4 (A and B) The apoptosis in doxorubicin-resistant U-2OS cells was inhibited, which could be reversed by downregulating MALAT-1. (C and D) Western blot revealed that in the doxorubicin-resistant U-2OS cells, the pERK/ERK ratio, Caspase 3 expression, and Bax expression were decreased, while Bcl-2 expression was increased. (E) The growth curves of osteosarcoma cells in vivo. (F) The solid osteosarcoma was collected on the 30th day. (G) The average weight of doxorubicin-resistant solid osteosarcoma was higher than other tumors.

Note: **P<0.01.
Abbreviations: DS, doxorubicin-sensitive U-2OS cells; DR, doxorubicin-resistant U-2OS cells; shCtrl, negative control; shMALAT1, downregulating MALAT-1 with shRNA; ERK, extracellular regulated protein kinases; Bcl-2, B-cell lymphoma-2; Bax, Bcl-2-associated X protein.