Diagnostic Value of Serum lncRNA HOTAIR Combined with Galectin-3 in Benign and Papillary Thyroid Carcinoma

Figures & data

Table 1 Primer Sequence

Gene	Forward 5ʹ-3’	Reverse 5ʹ-3’
LncRNA HOTAIR	GGTCTTGCCTCCTCTCTGTG	CTCTGGCCAGGAAAAGAGTG
GAPDH	CTCAGACACCATGGGGAAGGTGA	ATGATCTTGAGGCTGTTGTCATA

Table 2 Comparison of Baseline Data Between PTC Patients and Benign Thyroid Tumor Patients

Parameters		Control	PTC	P
		(N=150)	(N=160)
Age(years)	< 55	69	57	0.063
	≥55	81	103
Gender	Male	56	61	0.886
	Female	94	99
BMI	< 24	80	96	0.236
	≥24	70	64
Tumor size (cm)	< 2	–	75	–
	≥2	–	85	–
Multifocality	Unifocal	–	88	–
	Multifocal	–	72	–
TNM stage	I–II	–	117
	III–IV	–	43
T stage	T1-T2		83	–
	T3-T4		77	–
Lymph node metastasis	N0	–	66	–
	N1	–	94	–
Distant metastasis	M1	–	11	–
	M0	–	149	–
TSH (mU/L)		2.94 ± 0.68	3.25 ± 0.71	0.399
TPO-Ab (U/L)		2.59 ± 0.66	3.78 ± 0.73	< 0.001
TG-Ab (U/L)		2.63 ± 0.61	3.55 ± 0.69	< 0.001

Figure 1 LncRNA HOTAIR and Glactin-3 were highly expressed in PTC. Fasting peripheral venous blood was collected immediately after patient admission. (A) LncRNA HOTAIR expression in serum of PTC group and benign thyroid tumor group was detected by RT-qPCR; (B) Galectin-3 expression in serum was detected using ELISA. The data were expressed as mean ± standard deviation. T test was used for comparison among groups. **P < 0.01.

Table 3 Relationship Between lncRNA HOTAIR Expression and Clinical Baseline Characteristics in PTC Patients

Parameters		Total	LncRNA HOTAIR		P
			High (N=80)	Low (N=80)
Age(years)	< 55	57	31	26	0.409
	≥55	103	49	54
Gender	Male	61	35	26	0.143
	Female	99	45	54
BMI	< 24	96	45	51	0.333
	≥24	64	35	29
Tumor size (cm)	< 2	75	27	48	0.001
	≥2	85	53	32
Multifocality	Unifocal	88	45	43	0.751
	Multifocal	72	35	37
TNM stage	I–II	117	50	67	0.0042
	III–IV	43	30	13
T stage	T1-T2	83	28	55	<0.001
	T3-T4	77	52	25
Lymph node metastasis	N0	66	20	46	<0.001
	N1	94	60	34
Distant metastasis	M1	11	6	5	0.755
	M0	149	74	75
TSH (mU/L)		3.25 ± 0.71	3.17 ± 0.69	3.33 ± 0.73	0.156
TPO-Ab (U/L)		3.78 ± 0.73	3.91 ± 0.75	3.65 ± 0.69	< 0.024
TG-Ab (U/L)		3.55 ± 0.69	3.69± 0.67	3.41 ± 0.68	0.010

Table 4 Relationship Between Glactin-3 Expression and Clinical Baseline Characteristics in PTC Patients

Parameters		Total	LncRNA HOTAIR		P
			High (N=80)	Low (N=80)
Age(years)	< 55	57	33	24	0.137
	≥55	103	47	56
Gender	Male	61	32	29	0.625
	Female	99	48	51
BMI	< 24	96	46	50	0.519
	≥24	64	34	30
Tumor size (cm)	< 2	75	26	49	< 0.001
	≥2	85	54	31
Multifocality	Unifocal	88	41	47	0.340
	Multifocal	72	39	33
TNM stage	I–II	117	52	65	0.020
	III–IV	43	28	15
T stage	T1-T2	83	30	53	< 0.001
	T3-T4	77	50	27
Lymph node metastasis	N0	66	20	46	< 0.001
	N1	94	60	34
Distant metastasis	M1	11	6	5	0.755
	M0	149	66	83
TSH (mU/L)		3.25 ± 0.71	3.24 ± 0.75	3.26 ± 0.67	0.859
TPO-Ab (U/L)		3.78 ± 0.73	3.89 ± 0.73	3.67 ± 0.71	0.055
TG-Ab (U/L)		3.55 ± 0.69	3.56 ± 0.71	3.54 ± 0.67	0.855

Figure 2 LncRNA HOTAIR combined with Glactin-3 had higher diagnostic efficiency in differentiating benign thyroid tumor from PTC. (A) ROC curve analysis of diagnostic efficacy of lncRNA HOTAIR; (B) ROC curve analysis of diagnostic efficacy of Glactin-3; (C) ROC curve analysis of diagnostic efficacy of the combination of LncRNA HOTAIR and Glactin-3; (D) ROC curve was used to compare the diagnostic efficacy of lncRNA HOTAIR, Glactin-3, and their combination.