Targeting Oncogenic miR-181a-2-3p Inhibits Growth and Suppresses Cisplatin Resistance of Gastric Cancer

Figures & data

Table 1 Primers of RT-qPCR

miRNA Symbol	Article Number	Sequence
miR-181a-2-3p	HmiRQP0233	CCACTGACCGTTGACTGTACCA
let-7g-5p	HmiRQP0015	TGAGGTAGTAGTTTGTACAGTTAA
U6	HmiRQP9001	Not available

Abbreviation: U6, U6 small nuclear RNA.

Figure 1 MiRNA screening and validation from DDP-resistant and DDP-sensitive gastric cancer cell lines. (A) Venn diagram on total number (in parenthesis) and overlapping number of differentially expressed miRNAs calculated in cell line pairs consisting of the cisplatin-resistant (/DDP added to the paternal cell line’s name) relative to the cisplatin-sensitive paternal cell lines. (B) Relative expression level of miR-181a-2-3p in DDP-resistant and DDP-sensitive cells detected by RT-qPCR.

Table 2 The Correlation Between miR-181a-2-3p Expression and Clinical Parameters in GC Patients (n=91)

Clinical Parameters	Cases (n)	Serum Specimens		Tumor Samples
		Expression Level	P value	Expression Level	P value
Gender			0.2123		0.3625
Male	58	0.1127 (−1.3708, 3.0470)		0.4635 (−2.1063, 2.0662)
Female	33	−0.1065 (−2.4170, 2.5489)		−0.8298 (−1.3388, 1.3412)
Age (years)			0.6320		0.2960
< 60	31	−0.1631 (−1.4325, 2.3352)		−0.8329 (−1.3235, 1.2819)
≥60	60	0.6245 (−1.5613, 2.8365)		0.8827 (−2.1813, 2.0062)
Tumor size(cm)			0.0010***		0.0002***
< 5	28	−1.5476 (−3.1598, 2.0861)		−1.2899 (−2.8163, −0.6463)
≥5	63	1.1146 (−1.0845, 2.9981)		1.3134 (−1.3087, 2.1362)
Grades stage			0.6821		0.0184*
Good (G1+G2)	22	0.9554 (−0.4081, 2.3648)		−1.2738 (−2.9631, −0.5638)
Bad (G3+G4)	69	−0.1606 (−1.6248, 2.8651)		1.0944 (−1.6088, 1.8818)
CEA level			0.0200*		0.2320
Normal	50	−0.3892 (−2.2321, 2.3573)		−0.2090 (−1.9263, 1.3615)
Abnormal	41	1.1146 (−1.1296, 3.4678)		0.6718 (−1.5285, 2.7372)
CA724 level			0.1832		0.2877
Normal	35	−0.1065 (−1.6033, 2.3352)		0.2323 (−2.0533, 1.3618)
Abnormal	56	0.5118 (−1.4099, 3.0246)		0.0462 (−1.4539, 2.0837)
CA125 level			0.2751		0.4459
Normal	54	0.5234 (−1.3708, 2.7677)		0.0667 (−2.3832, 1.8362)
Abnormal	37	−0.6566 (−2.1921, 2.5514)		−0.4892 (−1.2688, 1.8716)
CA19-9 level			0.0015**		0.6427
Normal	30	−0.5406 (−3.0416, 1.3282)		−0.3302 (−2.4436, 1.8872)
Abnormal	61	1.1099 (−1.3211, 3.2041)		0.0027 (−1.3083, 1.7728)
T stage			0.0006***		0.0016**
T3	32	−1.4325 (−2.9116, 1.3625)		−1.3109 (−2.4332, 0.6987)
T4	59	1.3456 (−0.9364, 3.0516)		1.2024 (−1.2588, 2.6662)
N stage			0.5031		0.0280*
Absent	58	−0.2908 (−1.5127, 2.5864)		−0.7438 (−2.3481, 1.3633)
Present	33	1.2761 (−1.5545, 2.6645)		1.0937 (−1.6087, 3.4509)
M stage			0.9024		0.1329
Absent	48	−0.1952 (−1.5205, 2.6085)		1.2352 (−1.4763, 1.8737)
Present	43	0.8212 (−1.5476, 2.7016)		−0.8510 (−2.2489, 1.5262)
TNM stage			0.3231		<0.0001****
III	30	1.1846 (−0.5992, 2.6458)		−1.4804 (−3.0338, −1.0463)
IV	61	−0.4210 (−1.6248, 2.5761)		1.3636 (−0.1980, 2.6013)
Chemotherapy response			<0.0001****		<0.0001****
Sensitive (CR+PR)	41	−1.3873 (−2.4342, −0.2274)		−1.5298 (−3.0886, −0.8311)
Resistant (SD+PD)	50	2.5173 (0.3744, 3.5036)		1.3931 (−0.1513, 2.9487)

Notes: The formula for expression level is log₂(Fold Change). Expression levels are shown with median and quartile spacing. ****P < 0.0001, ***P < 0.001, **P < 0.01, and *P < 0.05.

Abbreviations: CR, complete response; PR, partial response; SD, stable disease; PD, progressive disease.

Figure 2 Expression levels and functions of miR-181a-2-3p in human gastric cancer clinical specimens. (A–C) miR-181a-2-3p expression was obviously increased in larger tumor size (≥5 cm; P= 0.0010) (A), higher T stage (T4; P= 0.0006) (B), and chemotherapy resistance (SD+PD; P< 0.0001) (C) in gastric cancer serum specimens. (D–F) miR-181a-2-3p expression was obviously increased in larger tumor size (≥5 cm; P= 0.0002) (D), higher T stage (T4; P= 0.0016) (E), and chemotherapy resistance (SD+PD; P< 0.0001) (F) in gastric cancer tumor samples. (G) A comparison between the serum specimen group (miR-181a-2-3p_serum) and the tumor samples group (miR-181a-2-3p_tumor) showed that the two compared areas were not significantly different (P= 0.708) by MedCalc software. (H) The compared areas of the combined two sample types group (miR-181a-2-3p_{serum + tumor}) and the serum specimen group (miR-181a-2-3p_serum) were significantly different (P= 0.011) by MedCalc software. (I) The compared areas of the combined two sample types group (miR-181a-2-3p_{serum + tumor}) and the tumor samples group (miR-181a-2-3p_tumor) were significantly different (P= 0.006) by MedCalc software.

Figure 3 Bioinformatics analysis and validation of miR-181a-2-3p in gastric cancer. (A) Starbase database showed miR-181a-2-3p got a higher expression in 372 gastric cancer samples, compared with 32 gastric normal samples. (B) RT-qPCR results proved that miR-181a-2-3p was at a relatively high level in most human gastric cancer cell lines (AGS, SGC-7901, BGC-823 and MGC-803), compared with human gastric epithelial cell line GES-1. (C and D) Compared to adjacent non tumor tissue, miR-181a-2-3p presented a higher level in gastric cancer tissue. (E–H) GC patients with higher miR-181a-2-3p levels had obviously shorter 10-year overall survival (OS) times than those with lower miR-181a-2-3p levels in Kaplan–Meier Plotter database (P= 0.053) (E), OncoLnc database (P= 0.00506) (F), OncomiR database (P= 0.003906) (G), and Starbase database (P= 0.0045) (H).

Figure 4 Overexpression of miR-181a-2-3p renders gastric cancer cells resistance to DDP. (A) RT-qPCR results confirm that miR-181a-2-3p level was significantly increased in SGC-7901 cells and MGC-803 cells transfected with miR-181a-2-3p mimics, compared with that in mimics control cells. (B) Cellular activity in SGC-7901 cells and MGC-803 cells transfected with miR-181a-2-3p mimics, compared with that in mimics control cells, was detected following treatment with various concentrations of DDP for 48 h. (C) SGC-7901 cells and MGC-803 cells transfected with the miR-181a-2-3p mimics showed marked increase in survival rates and higher DDP IC₅₀ values, compared with the mimics control cells. (D) Higher levels of miR-181a-2-3p were associated with increased cell proliferation after 2 weeks of culture with 0.2 μg/mL DDP in SGC-7901 cells or 0.8 μg/mL DDP in MGC-803 cells. (E) Compared with the mimics control cells, the relative colony forming efficiency in both SGC-7901 cells and MGC-803 cells transfected with the miR-181a-2-3p mimics got a significant increase. (F and G) Compared with the mimics control cells, SGC-7901 cells and MGC-803 cells transfected with miR-181a-2-3p mimics exhibited decreased rates of apoptosis following culture with 0.2 μg/mL DDP and 0.8 μg/mL DDP for 48 h, respectively.

Figure 5 Downregulation of miR-181a-2-3p sensitizes gastric cancer cells to DDP. (A) RT-qPCR results confirm that miR-181a-2-3p level was markedly reduced in SGC-7901/DDP cells and MGC-803/DDP cells transfected with miR-181a-2-3p inhibitor, compared with that in inhibitor control cells. (B) SGC-7901/DDP cells and MGC-803/DDP cells transfected with either miR-181a-2-3p inhibitor or inhibitor control were treated with a range of DDP concentrations for 48 h, after which viability was assessed. (C) miR-181a-2-3p-knockdown in SGC-7901/DDP cells and MGC-803/DDP cells resulted in increased survival rates and higher DDP IC₅₀ values, compared with the inhibitor control cells. (D and E) Following treatment with 0.5 μg/mL DDP in SGC-7901/DDP cells and 3 μg/mL DDP in MGC-803/DDP cells for 2 weeks, reduced levels of miR-181a-2-3p were also associated with decreased proliferation and colony formation. (F and G) Flow cytometric analysis revealed that after treatment with 0.1 μg/mL DDP in SGC-7901/DDP cells and 0.5 μg/mL DDP in MGC-803/DDP cells for 48 h, SGC-7901/DDP cells and MGC-803/DDP cells transfected with miR-181a-2-3p inhibitor exhibited increased apoptotic rate compared with the inhibitor control cells.